ID: 1130678908

View in Genome Browser
Species Human (GRCh38)
Location 15:85979426-85979448
Sequence GGGACGGGAAGGATCTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678908_1130678923 17 Left 1130678908 15:85979426-85979448 CCCAGCCAGATCCTTCCCGTCCC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678908_1130678924 18 Left 1130678908 15:85979426-85979448 CCCAGCCAGATCCTTCCCGTCCC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678908_1130678917 -2 Left 1130678908 15:85979426-85979448 CCCAGCCAGATCCTTCCCGTCCC No data
Right 1130678917 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data
1130678908_1130678915 -3 Left 1130678908 15:85979426-85979448 CCCAGCCAGATCCTTCCCGTCCC No data
Right 1130678915 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678908 Original CRISPR GGGACGGGAAGGATCTGGCT GGG (reversed) Intergenic
No off target data available for this crispr