ID: 1130678910

View in Genome Browser
Species Human (GRCh38)
Location 15:85979431-85979453
Sequence GCTGGGGGACGGGAAGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678910_1130678923 12 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678910_1130678917 -7 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678917 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data
1130678910_1130678924 13 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678910_1130678926 27 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678910_1130678915 -8 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678915 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678910 Original CRISPR GCTGGGGGACGGGAAGGATC TGG (reversed) Intergenic
No off target data available for this crispr