ID: 1130678911

View in Genome Browser
Species Human (GRCh38)
Location 15:85979437-85979459
Sequence GAGTGAGCTGGGGGACGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678911_1130678926 21 Left 1130678911 15:85979437-85979459 CCTTCCCGTCCCCCAGCTCACTC No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678911_1130678924 7 Left 1130678911 15:85979437-85979459 CCTTCCCGTCCCCCAGCTCACTC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678911_1130678923 6 Left 1130678911 15:85979437-85979459 CCTTCCCGTCCCCCAGCTCACTC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678911 Original CRISPR GAGTGAGCTGGGGGACGGGA AGG (reversed) Intergenic
No off target data available for this crispr