ID: 1130678913

View in Genome Browser
Species Human (GRCh38)
Location 15:85979442-85979464
Sequence GCAGGGAGTGAGCTGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678913_1130678926 16 Left 1130678913 15:85979442-85979464 CCGTCCCCCAGCTCACTCCCTGC No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678913_1130678924 2 Left 1130678913 15:85979442-85979464 CCGTCCCCCAGCTCACTCCCTGC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678913_1130678923 1 Left 1130678913 15:85979442-85979464 CCGTCCCCCAGCTCACTCCCTGC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678913 Original CRISPR GCAGGGAGTGAGCTGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr