ID: 1130678914

View in Genome Browser
Species Human (GRCh38)
Location 15:85979446-85979468
Sequence CCAGGCAGGGAGTGAGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678914_1130678926 12 Left 1130678914 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678914_1130678929 29 Left 1130678914 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data
1130678914_1130678924 -2 Left 1130678914 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678914_1130678923 -3 Left 1130678914 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678914 Original CRISPR CCAGGCAGGGAGTGAGCTGG GGG (reversed) Intergenic
No off target data available for this crispr