ID: 1130678915

View in Genome Browser
Species Human (GRCh38)
Location 15:85979446-85979468
Sequence CCCCCAGCTCACTCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678908_1130678915 -3 Left 1130678908 15:85979426-85979448 CCCAGCCAGATCCTTCCCGTCCC No data
Right 1130678915 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
1130678909_1130678915 -4 Left 1130678909 15:85979427-85979449 CCAGCCAGATCCTTCCCGTCCCC No data
Right 1130678915 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
1130678910_1130678915 -8 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678915 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678915 Original CRISPR CCCCCAGCTCACTCCCTGCC TGG Intergenic
No off target data available for this crispr