ID: 1130678917

View in Genome Browser
Species Human (GRCh38)
Location 15:85979447-85979469
Sequence CCCCAGCTCACTCCCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678908_1130678917 -2 Left 1130678908 15:85979426-85979448 CCCAGCCAGATCCTTCCCGTCCC No data
Right 1130678917 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data
1130678909_1130678917 -3 Left 1130678909 15:85979427-85979449 CCAGCCAGATCCTTCCCGTCCCC No data
Right 1130678917 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data
1130678910_1130678917 -7 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678917 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678917 Original CRISPR CCCCAGCTCACTCCCTGCCT GGG Intergenic
No off target data available for this crispr