ID: 1130678923

View in Genome Browser
Species Human (GRCh38)
Location 15:85979466-85979488
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678916_1130678923 -4 Left 1130678916 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678910_1130678923 12 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678912_1130678923 2 Left 1130678912 15:85979441-85979463 CCCGTCCCCCAGCTCACTCCCTG No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678909_1130678923 16 Left 1130678909 15:85979427-85979449 CCAGCCAGATCCTTCCCGTCCCC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678918_1130678923 -5 Left 1130678918 15:85979448-85979470 CCCAGCTCACTCCCTGCCTGGGT No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678911_1130678923 6 Left 1130678911 15:85979437-85979459 CCTTCCCGTCCCCCAGCTCACTC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678913_1130678923 1 Left 1130678913 15:85979442-85979464 CCGTCCCCCAGCTCACTCCCTGC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678914_1130678923 -3 Left 1130678914 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678919_1130678923 -6 Left 1130678919 15:85979449-85979471 CCAGCTCACTCCCTGCCTGGGTC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data
1130678908_1130678923 17 Left 1130678908 15:85979426-85979448 CCCAGCCAGATCCTTCCCGTCCC No data
Right 1130678923 15:85979466-85979488 TGGGTCAGATGCCTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678923 Original CRISPR TGGGTCAGATGCCTCTTTTC TGG Intergenic