ID: 1130678924

View in Genome Browser
Species Human (GRCh38)
Location 15:85979467-85979489
Sequence GGGTCAGATGCCTCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678916_1130678924 -3 Left 1130678916 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678908_1130678924 18 Left 1130678908 15:85979426-85979448 CCCAGCCAGATCCTTCCCGTCCC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678918_1130678924 -4 Left 1130678918 15:85979448-85979470 CCCAGCTCACTCCCTGCCTGGGT No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678913_1130678924 2 Left 1130678913 15:85979442-85979464 CCGTCCCCCAGCTCACTCCCTGC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678909_1130678924 17 Left 1130678909 15:85979427-85979449 CCAGCCAGATCCTTCCCGTCCCC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678914_1130678924 -2 Left 1130678914 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678910_1130678924 13 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678919_1130678924 -5 Left 1130678919 15:85979449-85979471 CCAGCTCACTCCCTGCCTGGGTC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678911_1130678924 7 Left 1130678911 15:85979437-85979459 CCTTCCCGTCCCCCAGCTCACTC No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data
1130678912_1130678924 3 Left 1130678912 15:85979441-85979463 CCCGTCCCCCAGCTCACTCCCTG No data
Right 1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678924 Original CRISPR GGGTCAGATGCCTCTTTTCT GGG Intergenic
No off target data available for this crispr