ID: 1130678926

View in Genome Browser
Species Human (GRCh38)
Location 15:85979481-85979503
Sequence TTTTCTGGGTTTTCCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678910_1130678926 27 Left 1130678910 15:85979431-85979453 CCAGATCCTTCCCGTCCCCCAGC No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678914_1130678926 12 Left 1130678914 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678921_1130678926 -2 Left 1130678921 15:85979460-85979482 CCTGCCTGGGTCAGATGCCTCTT No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678920_1130678926 -1 Left 1130678920 15:85979459-85979481 CCCTGCCTGGGTCAGATGCCTCT No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678911_1130678926 21 Left 1130678911 15:85979437-85979459 CCTTCCCGTCCCCCAGCTCACTC No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678912_1130678926 17 Left 1130678912 15:85979441-85979463 CCCGTCCCCCAGCTCACTCCCTG No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678918_1130678926 10 Left 1130678918 15:85979448-85979470 CCCAGCTCACTCCCTGCCTGGGT No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678919_1130678926 9 Left 1130678919 15:85979449-85979471 CCAGCTCACTCCCTGCCTGGGTC No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678913_1130678926 16 Left 1130678913 15:85979442-85979464 CCGTCCCCCAGCTCACTCCCTGC No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678922_1130678926 -6 Left 1130678922 15:85979464-85979486 CCTGGGTCAGATGCCTCTTTTCT No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data
1130678916_1130678926 11 Left 1130678916 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data
Right 1130678926 15:85979481-85979503 TTTTCTGGGTTTTCCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678926 Original CRISPR TTTTCTGGGTTTTCCCTCAG TGG Intergenic
No off target data available for this crispr