ID: 1130678929

View in Genome Browser
Species Human (GRCh38)
Location 15:85979498-85979520
Sequence CAGTGGTACTGACCCTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130678925_1130678929 -2 Left 1130678925 15:85979477-85979499 CCTCTTTTCTGGGTTTTCCCTCA No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data
1130678918_1130678929 27 Left 1130678918 15:85979448-85979470 CCCAGCTCACTCCCTGCCTGGGT No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data
1130678916_1130678929 28 Left 1130678916 15:85979447-85979469 CCCCAGCTCACTCCCTGCCTGGG No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data
1130678919_1130678929 26 Left 1130678919 15:85979449-85979471 CCAGCTCACTCCCTGCCTGGGTC No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data
1130678921_1130678929 15 Left 1130678921 15:85979460-85979482 CCTGCCTGGGTCAGATGCCTCTT No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data
1130678914_1130678929 29 Left 1130678914 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data
1130678920_1130678929 16 Left 1130678920 15:85979459-85979481 CCCTGCCTGGGTCAGATGCCTCT No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data
1130678922_1130678929 11 Left 1130678922 15:85979464-85979486 CCTGGGTCAGATGCCTCTTTTCT No data
Right 1130678929 15:85979498-85979520 CAGTGGTACTGACCCTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130678929 Original CRISPR CAGTGGTACTGACCCTAGAT TGG Intergenic
No off target data available for this crispr