ID: 1130681969

View in Genome Browser
Species Human (GRCh38)
Location 15:86004911-86004933
Sequence TTGTTCACCCTGAGCTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130681969_1130681970 -10 Left 1130681969 15:86004911-86004933 CCATACTAGCTCAGGGTGAACAA No data
Right 1130681970 15:86004924-86004946 GGGTGAACAAGCTTTTCCAGTGG No data
1130681969_1130681974 30 Left 1130681969 15:86004911-86004933 CCATACTAGCTCAGGGTGAACAA No data
Right 1130681974 15:86004964-86004986 CCTCCATTATTTTTCTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130681969 Original CRISPR TTGTTCACCCTGAGCTAGTA TGG (reversed) Intergenic
No off target data available for this crispr