ID: 1130681970

View in Genome Browser
Species Human (GRCh38)
Location 15:86004924-86004946
Sequence GGGTGAACAAGCTTTTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130681969_1130681970 -10 Left 1130681969 15:86004911-86004933 CCATACTAGCTCAGGGTGAACAA No data
Right 1130681970 15:86004924-86004946 GGGTGAACAAGCTTTTCCAGTGG No data
1130681966_1130681970 -2 Left 1130681966 15:86004903-86004925 CCTTGCTTCCATACTAGCTCAGG No data
Right 1130681970 15:86004924-86004946 GGGTGAACAAGCTTTTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130681970 Original CRISPR GGGTGAACAAGCTTTTCCAG TGG Intergenic
No off target data available for this crispr