ID: 1130682233

View in Genome Browser
Species Human (GRCh38)
Location 15:86006755-86006777
Sequence TACTTACCTCCTCTTAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130682233_1130682239 12 Left 1130682233 15:86006755-86006777 CCCCCTTTAAGAGGAGGTAAGTA No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data
1130682233_1130682238 11 Left 1130682233 15:86006755-86006777 CCCCCTTTAAGAGGAGGTAAGTA No data
Right 1130682238 15:86006789-86006811 GTTACTTGCTTAAGAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130682233 Original CRISPR TACTTACCTCCTCTTAAAGG GGG (reversed) Intergenic
No off target data available for this crispr