ID: 1130682239

View in Genome Browser
Species Human (GRCh38)
Location 15:86006790-86006812
Sequence TTACTTGCTTAAGAAACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130682233_1130682239 12 Left 1130682233 15:86006755-86006777 CCCCCTTTAAGAGGAGGTAAGTA No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data
1130682230_1130682239 18 Left 1130682230 15:86006749-86006771 CCACCTCCCCCTTTAAGAGGAGG No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data
1130682236_1130682239 9 Left 1130682236 15:86006758-86006780 CCTTTAAGAGGAGGTAAGTAACT No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data
1130682235_1130682239 10 Left 1130682235 15:86006757-86006779 CCCTTTAAGAGGAGGTAAGTAAC No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data
1130682229_1130682239 19 Left 1130682229 15:86006748-86006770 CCCACCTCCCCCTTTAAGAGGAG No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data
1130682232_1130682239 15 Left 1130682232 15:86006752-86006774 CCTCCCCCTTTAAGAGGAGGTAA No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data
1130682234_1130682239 11 Left 1130682234 15:86006756-86006778 CCCCTTTAAGAGGAGGTAAGTAA No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data
1130682227_1130682239 23 Left 1130682227 15:86006744-86006766 CCTGCCCACCTCCCCCTTTAAGA No data
Right 1130682239 15:86006790-86006812 TTACTTGCTTAAGAAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130682239 Original CRISPR TTACTTGCTTAAGAAACTTT GGG Intergenic
No off target data available for this crispr