ID: 1130684442

View in Genome Browser
Species Human (GRCh38)
Location 15:86024521-86024543
Sequence GTCTGGACAAGAACCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130684440_1130684442 -10 Left 1130684440 15:86024508-86024530 CCACAGAGAGATGGTCTGGACAA No data
Right 1130684442 15:86024521-86024543 GTCTGGACAAGAACCAGGTGAGG No data
1130684439_1130684442 -9 Left 1130684439 15:86024507-86024529 CCCACAGAGAGATGGTCTGGACA No data
Right 1130684442 15:86024521-86024543 GTCTGGACAAGAACCAGGTGAGG No data
1130684435_1130684442 27 Left 1130684435 15:86024471-86024493 CCATGTTAGTTGATGCAAGGGAT No data
Right 1130684442 15:86024521-86024543 GTCTGGACAAGAACCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130684442 Original CRISPR GTCTGGACAAGAACCAGGTG AGG Intergenic
No off target data available for this crispr