ID: 1130687155

View in Genome Browser
Species Human (GRCh38)
Location 15:86048713-86048735
Sequence ATGCTTCCTCTTTGCAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130687151_1130687155 7 Left 1130687151 15:86048683-86048705 CCACAGAAGCTCAGATGGAAGTT No data
Right 1130687155 15:86048713-86048735 ATGCTTCCTCTTTGCAATGCTGG No data
1130687150_1130687155 8 Left 1130687150 15:86048682-86048704 CCCACAGAAGCTCAGATGGAAGT No data
Right 1130687155 15:86048713-86048735 ATGCTTCCTCTTTGCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130687155 Original CRISPR ATGCTTCCTCTTTGCAATGC TGG Intergenic
No off target data available for this crispr