ID: 1130689872

View in Genome Browser
Species Human (GRCh38)
Location 15:86072916-86072938
Sequence GTTTCTAAGCGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130689872_1130689878 -1 Left 1130689872 15:86072916-86072938 CCCTCCATGATCCGCTTAGAAAC No data
Right 1130689878 15:86072938-86072960 CCTCAACCCAGAACTCCTCAGGG No data
1130689872_1130689883 14 Left 1130689872 15:86072916-86072938 CCCTCCATGATCCGCTTAGAAAC No data
Right 1130689883 15:86072953-86072975 CCTCAGGGAGACAGATTTGAGGG No data
1130689872_1130689876 -2 Left 1130689872 15:86072916-86072938 CCCTCCATGATCCGCTTAGAAAC No data
Right 1130689876 15:86072937-86072959 ACCTCAACCCAGAACTCCTCAGG No data
1130689872_1130689881 13 Left 1130689872 15:86072916-86072938 CCCTCCATGATCCGCTTAGAAAC No data
Right 1130689881 15:86072952-86072974 TCCTCAGGGAGACAGATTTGAGG 0: 5
1: 18
2: 58
3: 118
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130689872 Original CRISPR GTTTCTAAGCGGATCATGGA GGG (reversed) Intergenic
No off target data available for this crispr