ID: 1130689872 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:86072916-86072938 |
| Sequence | GTTTCTAAGCGGATCATGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1130689872_1130689878 | -1 | Left | 1130689872 | 15:86072916-86072938 | CCCTCCATGATCCGCTTAGAAAC | No data | ||
| Right | 1130689878 | 15:86072938-86072960 | CCTCAACCCAGAACTCCTCAGGG | No data | ||||
| 1130689872_1130689883 | 14 | Left | 1130689872 | 15:86072916-86072938 | CCCTCCATGATCCGCTTAGAAAC | No data | ||
| Right | 1130689883 | 15:86072953-86072975 | CCTCAGGGAGACAGATTTGAGGG | No data | ||||
| 1130689872_1130689876 | -2 | Left | 1130689872 | 15:86072916-86072938 | CCCTCCATGATCCGCTTAGAAAC | No data | ||
| Right | 1130689876 | 15:86072937-86072959 | ACCTCAACCCAGAACTCCTCAGG | No data | ||||
| 1130689872_1130689881 | 13 | Left | 1130689872 | 15:86072916-86072938 | CCCTCCATGATCCGCTTAGAAAC | No data | ||
| Right | 1130689881 | 15:86072952-86072974 | TCCTCAGGGAGACAGATTTGAGG | 0: 5 1: 18 2: 58 3: 118 4: 391 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1130689872 | Original CRISPR | GTTTCTAAGCGGATCATGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||