ID: 1130690024

View in Genome Browser
Species Human (GRCh38)
Location 15:86074232-86074254
Sequence CTGTATCCTCAGGTGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130690020_1130690024 10 Left 1130690020 15:86074199-86074221 CCTGTTTCATGGTTCACAGGTGG No data
Right 1130690024 15:86074232-86074254 CTGTATCCTCAGGTGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130690024 Original CRISPR CTGTATCCTCAGGTGGTGAA AGG Intergenic
No off target data available for this crispr