ID: 1130693171

View in Genome Browser
Species Human (GRCh38)
Location 15:86104178-86104200
Sequence GGTATTGGGGAGGATAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130693162_1130693171 3 Left 1130693162 15:86104152-86104174 CCCAAGGCTCCCAGATAACACAT No data
Right 1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG No data
1130693166_1130693171 -7 Left 1130693166 15:86104162-86104184 CCAGATAACACATTTTGGTATTG No data
Right 1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG No data
1130693163_1130693171 2 Left 1130693163 15:86104153-86104175 CCAAGGCTCCCAGATAACACATT No data
Right 1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG No data
1130693165_1130693171 -6 Left 1130693165 15:86104161-86104183 CCCAGATAACACATTTTGGTATT No data
Right 1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130693171 Original CRISPR GGTATTGGGGAGGATAAAGA TGG Intergenic
No off target data available for this crispr