ID: 1130693605

View in Genome Browser
Species Human (GRCh38)
Location 15:86107862-86107884
Sequence AAAGCCTGGTGCATCCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130693602_1130693605 -5 Left 1130693602 15:86107844-86107866 CCTCTCAGAGAGCTTCTCAAAGC No data
Right 1130693605 15:86107862-86107884 AAAGCCTGGTGCATCCATATGGG No data
1130693601_1130693605 -4 Left 1130693601 15:86107843-86107865 CCCTCTCAGAGAGCTTCTCAAAG No data
Right 1130693605 15:86107862-86107884 AAAGCCTGGTGCATCCATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130693605 Original CRISPR AAAGCCTGGTGCATCCATAT GGG Intergenic
No off target data available for this crispr