ID: 1130694752

View in Genome Browser
Species Human (GRCh38)
Location 15:86119782-86119804
Sequence TGGCAAACTATGCAGCTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130694752_1130694758 22 Left 1130694752 15:86119782-86119804 CCTAGTAGCTGCATAGTTTGCCA No data
Right 1130694758 15:86119827-86119849 TTGTGGATGGCTCCCCACAAGGG No data
1130694752_1130694755 9 Left 1130694752 15:86119782-86119804 CCTAGTAGCTGCATAGTTTGCCA No data
Right 1130694755 15:86119814-86119836 TTTAATTCTATCCTTGTGGATGG No data
1130694752_1130694757 21 Left 1130694752 15:86119782-86119804 CCTAGTAGCTGCATAGTTTGCCA No data
Right 1130694757 15:86119826-86119848 CTTGTGGATGGCTCCCCACAAGG No data
1130694752_1130694754 5 Left 1130694752 15:86119782-86119804 CCTAGTAGCTGCATAGTTTGCCA No data
Right 1130694754 15:86119810-86119832 CACTTTTAATTCTATCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130694752 Original CRISPR TGGCAAACTATGCAGCTACT AGG (reversed) Intergenic
No off target data available for this crispr