ID: 1130694755

View in Genome Browser
Species Human (GRCh38)
Location 15:86119814-86119836
Sequence TTTAATTCTATCCTTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130694751_1130694755 23 Left 1130694751 15:86119768-86119790 CCTGGTTGTGGGGTCCTAGTAGC No data
Right 1130694755 15:86119814-86119836 TTTAATTCTATCCTTGTGGATGG No data
1130694752_1130694755 9 Left 1130694752 15:86119782-86119804 CCTAGTAGCTGCATAGTTTGCCA No data
Right 1130694755 15:86119814-86119836 TTTAATTCTATCCTTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130694755 Original CRISPR TTTAATTCTATCCTTGTGGA TGG Intergenic
No off target data available for this crispr