ID: 1130695823

View in Genome Browser
Species Human (GRCh38)
Location 15:86130228-86130250
Sequence GGTAGTGTATGTTCATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130695823_1130695825 28 Left 1130695823 15:86130228-86130250 CCAGCAGATGAACATACACTACC No data
Right 1130695825 15:86130279-86130301 GTCTGCCACACTGTCAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130695823 Original CRISPR GGTAGTGTATGTTCATCTGC TGG (reversed) Intergenic
No off target data available for this crispr