ID: 1130696417

View in Genome Browser
Species Human (GRCh38)
Location 15:86136148-86136170
Sequence AGAATCTCCCAGCCAAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130696416_1130696417 -9 Left 1130696416 15:86136134-86136156 CCATGGGAAGCAGTAGAATCTCC No data
Right 1130696417 15:86136148-86136170 AGAATCTCCCAGCCAAGTTCTGG No data
1130696415_1130696417 3 Left 1130696415 15:86136122-86136144 CCTCAGTTAATACCATGGGAAGC No data
Right 1130696417 15:86136148-86136170 AGAATCTCCCAGCCAAGTTCTGG No data
1130696412_1130696417 25 Left 1130696412 15:86136100-86136122 CCAGTTGAGTGGCACTCAGTGAC No data
Right 1130696417 15:86136148-86136170 AGAATCTCCCAGCCAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130696417 Original CRISPR AGAATCTCCCAGCCAAGTTC TGG Intergenic
No off target data available for this crispr