ID: 1130704856

View in Genome Browser
Species Human (GRCh38)
Location 15:86223637-86223659
Sequence GCCCTCTTTTAACTGCCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130704852_1130704856 23 Left 1130704852 15:86223591-86223613 CCGTTTGAAGGATAAATGAAGTA 0: 1
1: 0
2: 2
3: 29
4: 284
Right 1130704856 15:86223637-86223659 GCCCTCTTTTAACTGCCCTATGG 0: 1
1: 0
2: 3
3: 10
4: 103
1130704854_1130704856 -6 Left 1130704854 15:86223620-86223642 CCATGAAAGCTAGCCTCGCCCTC 0: 1
1: 0
2: 1
3: 4
4: 79
Right 1130704856 15:86223637-86223659 GCCCTCTTTTAACTGCCCTATGG 0: 1
1: 0
2: 3
3: 10
4: 103
1130704853_1130704856 -2 Left 1130704853 15:86223616-86223638 CCATCCATGAAAGCTAGCCTCGC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1130704856 15:86223637-86223659 GCCCTCTTTTAACTGCCCTATGG 0: 1
1: 0
2: 3
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130704856 Original CRISPR GCCCTCTTTTAACTGCCCTA TGG Intronic