ID: 1130704856 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:86223637-86223659 |
Sequence | GCCCTCTTTTAACTGCCCTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 117 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 10, 4: 103} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1130704852_1130704856 | 23 | Left | 1130704852 | 15:86223591-86223613 | CCGTTTGAAGGATAAATGAAGTA | 0: 1 1: 0 2: 2 3: 29 4: 284 |
||
Right | 1130704856 | 15:86223637-86223659 | GCCCTCTTTTAACTGCCCTATGG | 0: 1 1: 0 2: 3 3: 10 4: 103 |
||||
1130704854_1130704856 | -6 | Left | 1130704854 | 15:86223620-86223642 | CCATGAAAGCTAGCCTCGCCCTC | 0: 1 1: 0 2: 1 3: 4 4: 79 |
||
Right | 1130704856 | 15:86223637-86223659 | GCCCTCTTTTAACTGCCCTATGG | 0: 1 1: 0 2: 3 3: 10 4: 103 |
||||
1130704853_1130704856 | -2 | Left | 1130704853 | 15:86223616-86223638 | CCATCCATGAAAGCTAGCCTCGC | 0: 1 1: 0 2: 0 3: 2 4: 50 |
||
Right | 1130704856 | 15:86223637-86223659 | GCCCTCTTTTAACTGCCCTATGG | 0: 1 1: 0 2: 3 3: 10 4: 103 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1130704856 | Original CRISPR | GCCCTCTTTTAACTGCCCTA TGG | Intronic | ||