ID: 1130708901

View in Genome Browser
Species Human (GRCh38)
Location 15:86260137-86260159
Sequence TTGGAGGCACAGCAAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130708901 Original CRISPR TTGGAGGCACAGCAAGAGCA AGG Intronic
900433444 1:2613660-2613682 TTGGAGTCAAAGCATGAGGAGGG + Intronic
900700584 1:4046414-4046436 TTGGGGGCAGAGTGAGAGCAAGG + Intergenic
902721595 1:18307893-18307915 TCTGAAGCACAGCATGAGCAAGG - Intronic
902837656 1:19057580-19057602 TTGGAGGAACAGAAAGGCCAGGG + Intergenic
903820028 1:26094961-26094983 GTGGATGAACAGCAAGATCAGGG + Intergenic
904241445 1:29148841-29148863 CAGGAGCCGCAGCAAGAGCAAGG - Exonic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
904918541 1:33987711-33987733 TTGGAGGCACGGCAAGGGTGAGG - Intronic
906066016 1:42980618-42980640 TTTGAGGAACAGCAAATGCAGGG + Intergenic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906874537 1:49522797-49522819 GTAGAAGCACAGCATGAGCACGG + Intronic
906923754 1:50092216-50092238 TTGGAAACACAAAAAGAGCATGG + Intronic
906933434 1:50191191-50191213 TTGGCAACACAGCAAGAACAAGG - Intronic
907995758 1:59630408-59630430 ATGGAGGAACAGCAAGGACAGGG + Intronic
909997167 1:82294939-82294961 TTGGCAGCAAATCAAGAGCAAGG + Intergenic
910170163 1:84368753-84368775 AGGGAGGCACAGCCAGAGGAAGG + Intronic
910529998 1:88225134-88225156 TTGGGAGCACAGCAAGAGGAAGG - Intergenic
910546084 1:88420752-88420774 TGGCAGGAAGAGCAAGAGCATGG + Intergenic
911256268 1:95637074-95637096 ATGCAGGGACAGGAAGAGCATGG - Intergenic
915007787 1:152656057-152656079 ATGGAAGCACCACAAGAGCAGGG - Intergenic
915444285 1:155966077-155966099 TTGGTGTAACAGAAAGAGCATGG - Intronic
915884282 1:159705918-159705940 TTCCAGGCACACCAATAGCAGGG - Intergenic
919109871 1:193205408-193205430 CTGGAGGCACATCAAAAGTATGG + Intronic
919299654 1:195744064-195744086 TTGGAGGCAGGACAAGAGCTAGG + Intergenic
920388586 1:205584850-205584872 CAGGAGGCACAGGAAGAACAGGG - Intronic
922536733 1:226386510-226386532 CTGGAGGCTCAGCATGACCAGGG - Intronic
922977920 1:229800659-229800681 TTGGAGGGGCAGCAGGAACAGGG + Intergenic
1062849029 10:729021-729043 ATGGTGGCACAGGAAGGGCATGG - Intergenic
1063070569 10:2658983-2659005 TTGGAGGCACAGCCTTACCAGGG + Intergenic
1064219841 10:13431245-13431267 ATTGAGGCCCAGCAAGGGCAAGG - Intergenic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1065598401 10:27341339-27341361 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066466614 10:35656350-35656372 TTGGAGGAAGAGGAAGATCAAGG - Intergenic
1066603106 10:37129785-37129807 TTGAAGGCAGAGAAAGAGCGTGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067318461 10:45194340-45194362 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1069544759 10:69320084-69320106 TTAGATGCACAGGAAGAGGATGG - Intronic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1070935132 10:80288142-80288164 TTTGAGGAAGAACAAGAGCAAGG + Intronic
1070998209 10:80805459-80805481 ATTGGGGCACAGCAAAAGCAAGG - Intergenic
1072330074 10:94339783-94339805 TTGGAAGAACATGAAGAGCAAGG + Exonic
1072566190 10:96618699-96618721 TATGAGGCACAGCAAGGTCAAGG + Intronic
1075394611 10:122117926-122117948 TAGGAGCCACAGCAAGCCCAAGG - Intronic
1075629549 10:123992532-123992554 TTGGAGGGGCACCAACAGCAGGG + Intergenic
1075852660 10:125601943-125601965 TTGGCAGAGCAGCAAGAGCAGGG - Intronic
1076399672 10:130173426-130173448 TTTGGCGCCCAGCAAGAGCATGG - Intronic
1076543915 10:131231352-131231374 GTGGAGGCACAGGAAGCACACGG - Intronic
1077442356 11:2574647-2574669 GAGGAGGCACAGCAATCGCAGGG - Intronic
1078101908 11:8334923-8334945 CTGGAAGCAGACCAAGAGCAGGG - Intergenic
1079058717 11:17229124-17229146 TTGTAGCCACAGCTAGAGCCTGG - Intronic
1079195260 11:18321306-18321328 ATGGAGGCACAGCAAGTTTATGG - Intronic
1079241620 11:18726124-18726146 TTGGAGGCTCAGCTAGTGCCTGG + Exonic
1080277217 11:30516007-30516029 TAGCAGGCACAGCAAATGCATGG + Intronic
1081475252 11:43423480-43423502 ATAGAGGCACTGGAAGAGCAGGG + Intronic
1081731731 11:45376474-45376496 TTGGAGGAAAAGCCACAGCAAGG - Intergenic
1082207124 11:49451088-49451110 ATGAAGGCACAGCAAGAATATGG + Intergenic
1083633927 11:64109866-64109888 CGGAAGGCACAGCAGGAGCAGGG + Intronic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1084321407 11:68375447-68375469 TGGTGGGCACAGCACGAGCAGGG - Intronic
1085697399 11:78716699-78716721 TTGGAGGCACAGCCAGATTTGGG + Intronic
1087549686 11:99633293-99633315 ATGCAGGCATAGCAGGAGCAAGG - Intronic
1087852513 11:103048623-103048645 TTGGAGGCTGAGTAAGAGCCAGG + Intergenic
1088698313 11:112389387-112389409 TTGGAAGAGGAGCAAGAGCACGG - Intergenic
1088724133 11:112619605-112619627 TAGGAGGCCCAGCAAAGGCAGGG + Intergenic
1088756342 11:112888403-112888425 TGGGAGGCACAGGAAAAGTAGGG + Intergenic
1088760311 11:112923002-112923024 TAGGAGGCATACTAAGAGCAGGG + Intergenic
1090414817 11:126533751-126533773 ATGGAGGCTCAGCAAGTTCATGG - Intronic
1091633488 12:2179898-2179920 TTTGAAGCAGAGAAAGAGCATGG - Intronic
1091915548 12:4270068-4270090 TAGGAGGCACATCAAGAGGAAGG - Intergenic
1091944177 12:4520431-4520453 TGGGAGGCAGAGCAAAAGTATGG + Intronic
1092190017 12:6512414-6512436 GTGGAGGAATAGCAAGGGCAGGG + Intronic
1092523208 12:9294006-9294028 TGAGAGGCACAGCAACGGCAGGG - Intergenic
1092544084 12:9437893-9437915 TGAGAGGCACAGCAACGGCAGGG + Intergenic
1092994351 12:13934210-13934232 TTGGACACAGAGGAAGAGCATGG - Intronic
1094053001 12:26240834-26240856 TGGGAGGGACAGCCACAGCACGG - Intronic
1094535091 12:31314106-31314128 GTGGAAGGACAACAAGAGCAGGG + Intronic
1095038239 12:37418026-37418048 GGGGAGGCACAGCAAGAGTGAGG + Intergenic
1095350614 12:41206581-41206603 TTGAAGGCACAGCAAAAGGCAGG - Intronic
1095980986 12:47974722-47974744 CTGGTGGAGCAGCAAGAGCAAGG - Exonic
1096363832 12:51011479-51011501 TTGGAGGCAAAGGCAGAGAATGG - Intronic
1096872888 12:54605241-54605263 TTGAAGGCCCAGCCAGAGCCTGG + Intergenic
1100892170 12:99137745-99137767 ATGGAAGCACAGAAAAAGCATGG - Intronic
1101868166 12:108538822-108538844 ATGGAGGAAAAGCAAGAGTAGGG + Intronic
1102465972 12:113131027-113131049 TCGGAGGCACAGACAGAGAAGGG + Intronic
1102694498 12:114787601-114787623 TAGAAGACACAGCAAGTGCAAGG + Intergenic
1104732317 12:131114614-131114636 CTGGAGGCCCACCCAGAGCATGG + Intronic
1104962066 12:132493095-132493117 ATTGAGGCAGAGCAAGAGCAAGG + Intronic
1105224148 13:18413019-18413041 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1105625745 13:22110935-22110957 TGGGAGGGGCAGCAAGAGCCTGG + Intergenic
1106251242 13:27983169-27983191 TTTGGGGCACAGAAAGATCAAGG - Intronic
1107773604 13:43814251-43814273 TAGGAGGCACTGCAAAAGAATGG - Intergenic
1109413366 13:62004133-62004155 TGGGAGTCACAGCCAGAGCTGGG - Intergenic
1110163687 13:72410827-72410849 TTGGCTGCATAGCAAGTGCAAGG - Intergenic
1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG + Intergenic
1111763029 13:92489767-92489789 TTGGAGGTACAGACAGAGCTGGG + Intronic
1112998604 13:105604585-105604607 GTGAAGGCCCAGCAAGAGGAAGG - Intergenic
1113462609 13:110492470-110492492 AGGGACGCACAGCAAGATCAGGG + Intronic
1113479415 13:110609568-110609590 CTGGAGGCACAACAAACGCAAGG - Intergenic
1113494924 13:110719429-110719451 TTCGAGGCGCAGCAGGAGCTGGG + Exonic
1114008293 14:18337858-18337880 TTGAAGGCAGAGAAAGAGAATGG + Intergenic
1114866565 14:26601607-26601629 TTGTAGGAAAAGCAAGAGAATGG - Intergenic
1116101841 14:40448153-40448175 TAGGAGGGACAGAAAGAGCTAGG - Intergenic
1117205235 14:53435616-53435638 GTGGTGGCACAGCATGAGCATGG + Intergenic
1117293999 14:54362280-54362302 TGTGAGGCACAGCAAGAACACGG - Intergenic
1117654898 14:57945056-57945078 TTGGATGCAAAGGAAGACCAAGG - Intronic
1119119055 14:72056277-72056299 TTGGAGGCATACTATGAGCAGGG - Intronic
1119150087 14:72350956-72350978 TTAGAGGCAAAGTTAGAGCACGG - Intronic
1119472709 14:74909593-74909615 CTGGAGGCGCTGCACGAGCAGGG - Exonic
1120867660 14:89309557-89309579 TTGGAGCAACAGCAAAACCAAGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1123112797 14:105880968-105880990 CTGGAGGCCCAGCCAGAGAAGGG - Intergenic
1123391489 15:19878446-19878468 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1123506295 15:20942995-20943017 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1123563521 15:21516699-21516721 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1123599773 15:21953986-21954008 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1127332502 15:57952663-57952685 TTAGAGGAACAGAAGGAGCATGG - Intergenic
1127544425 15:59976991-59977013 ATGCAGGTACAGCAAGAGCAAGG + Intergenic
1127655108 15:61048384-61048406 TTAGCGGCTCAGCAAGACCATGG + Intronic
1127711588 15:61604492-61604514 TTGGGGGCTCAGGATGAGCAGGG - Intergenic
1129148551 15:73671786-73671808 TTGGAGCCACAGCACGGGGAGGG - Intergenic
1130152232 15:81319941-81319963 TAGGAGGCTGAGCAAGTGCAGGG - Intronic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1131217762 15:90553707-90553729 GTGGAGGGGCAGCAATAGCATGG + Intronic
1131514051 15:93065834-93065856 TTGGAGGGGCAGCAACAGCAGGG - Intronic
1131529693 15:93180774-93180796 TTCAAGGCACAGCAAGAGACTGG - Intergenic
1131903735 15:97117879-97117901 TGGGTGGCACAGCTAGAGCCTGG - Intergenic
1202971879 15_KI270727v1_random:243836-243858 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1132851190 16:2025744-2025766 TTGGAGACAGAGGAAGAGCTGGG + Intronic
1132949917 16:2555767-2555789 TAGATGGCACTGCAAGAGCAGGG - Intronic
1132964431 16:2644400-2644422 TAGATGGCACTGCAAGAGCAGGG + Intergenic
1133206617 16:4237892-4237914 GGGGAGGCACAGGAAAAGCAAGG - Intronic
1133328661 16:4957992-4958014 TTGGAGGCAGAGCTAGATTAGGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133756424 16:8765639-8765661 TGAGAGACACAGCAAGAGCAAGG + Intronic
1134210507 16:12272385-12272407 TTGGAGTCACGGGTAGAGCAGGG + Intronic
1134565823 16:15251154-15251176 ATGGAAGTTCAGCAAGAGCAGGG + Intergenic
1134686181 16:16160087-16160109 TTAGAGGAACAGCAAGAAGACGG - Intronic
1134736672 16:16505544-16505566 ATGGAAGTTCAGCAAGAGCAGGG - Intergenic
1134930845 16:18206624-18206646 ATGGAAGTTCAGCAAGAGCAGGG + Intergenic
1137879886 16:52034996-52035018 TTGGAGGTACAGCTGGAACAGGG - Intronic
1138851841 16:60639120-60639142 TTGGAAGCTCATCAAAAGCAGGG - Intergenic
1140051789 16:71488029-71488051 TGGGAGTCTTAGCAAGAGCAAGG + Intronic
1140164185 16:72531821-72531843 TTGGACGCACAGATAGAGAACGG - Intergenic
1140306461 16:73807476-73807498 TGGGAGACACAGCAAGACCATGG - Intergenic
1142943420 17:3403091-3403113 TTGTAGGGACAGGAAGAACATGG - Intergenic
1143491972 17:7290013-7290035 TTGGAGGGGCACCAACAGCAGGG - Exonic
1143890089 17:10096339-10096361 TTGGAGGCACAGAAAAAACTTGG - Intronic
1144004785 17:11089999-11090021 TTGGAGGCAGAGCAAGGAGACGG - Intergenic
1144463894 17:15481199-15481221 TTAGACACACAGCTAGAGCATGG + Intronic
1145840196 17:27988308-27988330 TTGGAAGCACAGGAGCAGCATGG - Intergenic
1146927000 17:36752095-36752117 TGGGGGACACAGCAAGTGCAGGG + Intergenic
1147592583 17:41694212-41694234 TTGGAGGAACTTCTAGAGCAAGG + Intergenic
1147688949 17:42303874-42303896 TTGGGGTGACAGGAAGAGCAAGG + Intronic
1149981973 17:61318009-61318031 GTGAAAGCACAGCAAGAACAGGG + Intronic
1150220908 17:63495414-63495436 CTGGAAGCCCAGCAAGGGCAGGG + Intronic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1154026912 18:10716551-10716573 AAGGAGGCACAGGAAGAGAACGG + Intronic
1154107433 18:11534501-11534523 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1154170209 18:12046105-12046127 GTGGAGGAACAGCCAGGGCAAGG - Intergenic
1154475546 18:14752458-14752480 TTGAAGGTAGAGAAAGAGCATGG + Intronic
1154529158 18:15326093-15326115 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1156354295 18:36328363-36328385 TGGGGGGAACAGCAAGTGCAAGG + Intronic
1156645463 18:39156290-39156312 TTGGATGCAAAACAAGAGCTTGG + Intergenic
1156786526 18:40921771-40921793 TAGGCTGCACAGCAAAAGCATGG - Intergenic
1158320245 18:56254252-56254274 TTGGAGGTACAAGAAGAACAAGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160929521 19:1563605-1563627 TTGGGGTCTCAGCAGGAGCAGGG + Intronic
1161144571 19:2670163-2670185 TTGGAGGAACAAAAACAGCAGGG + Intronic
1161317496 19:3624528-3624550 CTCGAGGCAGAGCAAGAGCGAGG + Intronic
1162722451 19:12670434-12670456 TTGGGGGAACAGCAAGGACAGGG - Exonic
1162892927 19:13747193-13747215 TTGGGGGAACAGCAAATGCAGGG - Intronic
1166147988 19:40850336-40850358 TTGGCAGCAGAGGAAGAGCAAGG - Exonic
1166178038 19:41088540-41088562 CTGGCGGCAGAGGAAGAGCAGGG + Exonic
1167722150 19:51186181-51186203 TTGGCCCCACAGCAAGGGCAGGG + Intergenic
1168433053 19:56296330-56296352 TTGGAGGCTCAGCAAGCCTAAGG - Exonic
925951652 2:8919040-8919062 ATGGAGGAACCTCAAGAGCACGG - Intronic
926528052 2:14007561-14007583 TATGACGCACAGCAAAAGCATGG - Intergenic
927342063 2:21993595-21993617 TTGGAGAAACAGCAAGAAAAAGG - Intergenic
927532086 2:23815437-23815459 TAGGAGTCACAGGAAGAGAAGGG + Intronic
927945624 2:27133552-27133574 TTCCAGGCACATCAACAGCAGGG - Exonic
928327702 2:30333256-30333278 CTGAACGCACAGCCAGAGCAGGG - Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929309828 2:40409827-40409849 TTGAAGGCAAAGCAGGATCAAGG - Intronic
930019710 2:46994182-46994204 TTGGAGGGACTGAAGGAGCAAGG + Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
932307680 2:70715549-70715571 TTGACTGCACACCAAGAGCAGGG - Intronic
933836775 2:86252171-86252193 TTTCAGGCCCAGCAAGAACAAGG - Intronic
934494646 2:94787090-94787112 CTGGAGGCAGGGCAAGAGGAAGG - Intergenic
934603669 2:95678384-95678406 TTGTTGGCACTGAAAGAGCACGG + Intergenic
935744582 2:106179260-106179282 TTGAAGTCAGAGCAAGAGCGGGG - Intronic
936029114 2:109057636-109057658 TCGGAGGCTCAGAAAGACCAAGG - Intergenic
936111910 2:109671509-109671531 TTGGAGGTGCAGCCAGGGCAAGG + Intergenic
936537049 2:113320622-113320644 TTGTTGGCACTGAAAGAGCACGG + Intergenic
937915903 2:127098565-127098587 TTGGGGTCACAGCAACAGCATGG - Intronic
938528260 2:132157509-132157531 TTGAAGGCAGAGAAAGAGCATGG - Intronic
939073627 2:137573122-137573144 TTGGAAGCACAACAGGAGTATGG + Intronic
939547077 2:143567263-143567285 TTGAAGGCACAGTAAGAGCTAGG - Intronic
940798621 2:158107612-158107634 TTGGAGGCAGAGGAAAAGGAAGG + Intronic
941394791 2:164961210-164961232 CAGGAGGCAAAGCAGGAGCAAGG + Intergenic
942126170 2:172827813-172827835 TTGGATGCATAGACAGAGCAGGG + Intronic
942532977 2:176932623-176932645 TTCGAGGTACAGTATGAGCAGGG - Intergenic
943797735 2:192018064-192018086 ATGGAGTCACAGCAAGAGATTGG + Intronic
944644388 2:201763549-201763571 TTGTAGCCACAGCTAGAGCCTGG - Intronic
945058651 2:205889528-205889550 CTGGAGGCACAGGAAGGGCAGGG + Intergenic
945201421 2:207285484-207285506 CTTGAGTCCCAGCAAGAGCAGGG - Intergenic
947170486 2:227306174-227306196 ATGGGGCAACAGCAAGAGCAAGG + Intronic
947985762 2:234446321-234446343 TTGCAGGCCCAGCAAGGACAGGG + Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948709875 2:239818982-239819004 TTGGAGGGACAGCGAGAGTGTGG - Intergenic
948893894 2:240919423-240919445 TTGGAGGCAGAGCAGGGGCCTGG - Intronic
1169323091 20:4651429-4651451 TTGGAGGTACAACAAGGGGAAGG - Intergenic
1169359853 20:4938839-4938861 TTGGAGGGATGGCATGAGCAGGG - Intronic
1170147443 20:13192234-13192256 TTGGAGGTACATAAAGAACAGGG + Intergenic
1171096565 20:22337588-22337610 TTGGTAGCACAGCAAGATGAAGG + Intergenic
1171573759 20:26277958-26277980 GGGGAGGCACAGCAAGAGGGAGG - Intergenic
1171806852 20:29688482-29688504 GGGGAGGCACAGCAAGAGGGAGG - Intergenic
1172086868 20:32392135-32392157 TGGGTGGCACAGCAAGACCTTGG - Intronic
1172768237 20:37362544-37362566 TTGGTCACACAGCAAGACCAAGG - Intronic
1173010374 20:39176547-39176569 TTGGTGTCACAGCATGAGCCAGG - Intergenic
1173502070 20:43561258-43561280 TCTGAGGGACAGCAAGAGAAAGG + Intronic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1175039442 20:56033127-56033149 GTGAAGGCACAGCAAGAAGATGG - Intergenic
1175763701 20:61578676-61578698 TTCCATGCACAGCAAGTGCAAGG - Intronic
1175943140 20:62547099-62547121 TTCAAGGCACAGCCAGAGCTGGG + Intergenic
1175985792 20:62763659-62763681 TGGGAGGCAGAGCCTGAGCAAGG + Intergenic
1176078959 20:63262177-63262199 TTGGAAGCACAGGAAGCGCCTGG + Intronic
1176193540 20:63825546-63825568 TTGGAGGAACAGCAAGTGCAGGG - Intronic
1176768240 21:13042394-13042416 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1177845036 21:26279176-26279198 TTGGAGGTGCAGGGAGAGCAAGG + Intergenic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1179286106 21:39978554-39978576 TGGGAGAGACAGCATGAGCAGGG + Intergenic
1179835312 21:44027882-44027904 GTGAGGGCACAGCAAGACCAAGG + Intronic
1180432798 22:15268675-15268697 TTGAAGGCAGAGAAAGAGAATGG + Intergenic
1180515371 22:16136621-16136643 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1183472526 22:38017132-38017154 TGGGTGGCACAGCAAGCCCAGGG - Intronic
1184040483 22:41940171-41940193 AAGGAGGAACAGCAAGTGCATGG - Intronic
1184208859 22:43023513-43023535 TTGGAGGCTCAGCAGAAGAAGGG - Intergenic
1184406951 22:44305747-44305769 TTGGGGGCACAGCCAGGCCATGG - Intronic
1185098738 22:48826301-48826323 CCGGAGGGACAGCAAGGGCATGG - Intronic
949808150 3:7977777-7977799 TTGGAGGCACTGTAGCAGCAGGG + Intergenic
950254730 3:11495046-11495068 TGGGTGACAGAGCAAGAGCAAGG + Intronic
950493299 3:13319111-13319133 CTGCAGGCACAGCAAGATCCCGG + Exonic
950681997 3:14591888-14591910 CAGGAGGCACATCAAGAGGAAGG + Intergenic
952741362 3:36737996-36738018 GAGGAGACCCAGCAAGAGCATGG - Exonic
953473989 3:43190551-43190573 TTGGAAGCACAGGGAGATCAGGG - Intergenic
954301699 3:49703840-49703862 CTGAGGGCACAGCGAGAGCAAGG + Intronic
954403969 3:50334872-50334894 TCGGATGCACAGCAGGACCATGG + Intronic
954767039 3:52927829-52927851 TTGGATGCACAGCAAGCACTGGG - Intronic
955980071 3:64515885-64515907 TTGGAGGGGCAGAAAGACCATGG + Exonic
958450269 3:94264771-94264793 TTGGAGGCAGAGTGAGACCAGGG - Intergenic
960344546 3:116516555-116516577 CTGGAAGCCCAGCAAGACCAGGG - Intronic
960795942 3:121487856-121487878 TTGGAGACAAAACAAGTGCAGGG - Exonic
961018571 3:123485552-123485574 TTGGTGGCAGAGGAAGAGGAGGG + Intergenic
961047334 3:123718592-123718614 TGGGCAGCACAGCAAGTGCAAGG - Intronic
961534323 3:127560403-127560425 AAGGAGGCACAGTAAGTGCACGG - Intergenic
961944797 3:130674480-130674502 TGGCAGGCACAGAAAGAGCCTGG - Intronic
962398070 3:135034889-135034911 TAGGATGCACAGCCAGAGGAAGG + Intronic
962627597 3:137241935-137241957 TTGGAGACACAGTAAGGGCCAGG - Intergenic
963073054 3:141320754-141320776 TTAGAGGGACAGGAAGAGAAGGG + Intergenic
963429127 3:145174590-145174612 TTGGAAACACGGCAACAGCAAGG + Intergenic
963659922 3:148112533-148112555 GTGGAGGCAGGGCAAGATCAAGG - Intergenic
963712824 3:148767140-148767162 TGTAAGGCACAGGAAGAGCATGG - Intergenic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
966259005 3:177953003-177953025 TTGCAGGCAAAGAGAGAGCAAGG + Intergenic
967812860 3:193775094-193775116 TGGAAGGCACAGCAAGAACAAGG + Intergenic
968717200 4:2169174-2169196 AGGAAGGCACAGCCAGAGCACGG + Intronic
968902082 4:3436599-3436621 TGGCAGGCACAGCGGGAGCAGGG - Intronic
969103388 4:4786749-4786771 TTGGAGGCTGGGCAAGACCAAGG + Intergenic
969333923 4:6495562-6495584 TTGGAATCACTGCCAGAGCATGG - Intronic
970142083 4:12993980-12994002 TTGGAGGCACAGCAGTACCTGGG + Intergenic
970773828 4:19648602-19648624 TGGAAGGCAAAGGAAGAGCAAGG + Intergenic
971251821 4:24979009-24979031 TTGGGGGCACAGGAATTGCAGGG + Intronic
972140218 4:35950026-35950048 TAGGAGGCAAAGCAAAAACATGG - Intronic
972800913 4:42474767-42474789 TTGGAGGAACAGCAAAAGCTAGG - Intronic
975249595 4:72163182-72163204 TTGGAGCCAAATCAAGAACATGG - Intergenic
976120609 4:81776770-81776792 TATGAGGCACAGCAAAAGTAAGG + Intronic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
981442339 4:144797402-144797424 TAGAAGGCAAAGCAGGAGCAGGG - Intergenic
981467723 4:145093109-145093131 CTGGAGGTAGGGCAAGAGCATGG + Intronic
981750671 4:148090341-148090363 TTGGGGGACCAGCAAGTGCAGGG + Intronic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
982812552 4:159844277-159844299 TTGGAGGAAAAGCAGGAGCCTGG - Intergenic
983316536 4:166139554-166139576 AGGGAAGCAGAGCAAGAGCAAGG - Intergenic
984654306 4:182300618-182300640 GTGGAGACATAGCAAGTGCAAGG - Intronic
985206036 4:187538131-187538153 TAGGAGGCACAGCATGAACTGGG - Intergenic
985680755 5:1254435-1254457 TTGGTGGCACAGCCACTGCACGG + Exonic
985986333 5:3519730-3519752 TTGGAGGCCAACCAAGTGCAGGG - Intergenic
987822961 5:22990391-22990413 TTGGAGGCAGAGCAAGATGGTGG + Intergenic
988165398 5:27582797-27582819 TTGGGGGTAGAGCAAGGGCATGG + Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
992381850 5:76245284-76245306 TTGGAGGAAGAGGAAGAGGAAGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993130070 5:83885688-83885710 TTGGGGGCACAGGGAGAGAAAGG - Intergenic
994847985 5:105015045-105015067 TTGGAGGAATTTCAAGAGCAAGG + Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996412192 5:123170419-123170441 TGGGAGGCACAGCAAGAGAGAGG - Intronic
996472591 5:123877707-123877729 TTGGAGGCAGCCCAGGAGCAGGG - Intergenic
998230247 5:140357183-140357205 TTGGGGCCACAGAAAGGGCAAGG + Intergenic
998560928 5:143170937-143170959 TTGGGGAGACAACAAGAGCATGG + Intronic
999149940 5:149420201-149420223 TGGGAGGAACAGCAGAAGCAGGG - Intergenic
999609130 5:153350606-153350628 TAGGAGGCATAGAAAGAGCTGGG + Intergenic
1002317054 5:178350105-178350127 TTGTAGGCAGGGGAAGAGCATGG - Intronic
1003188735 6:3854714-3854736 TTGCATGCACAGCAAGAGACAGG + Intergenic
1003993671 6:11515205-11515227 TTTAAGGCAGAGGAAGAGCAAGG - Intergenic
1004956893 6:20737135-20737157 ATGGAGGCACAGAAAGCTCAGGG - Intronic
1005140167 6:22622755-22622777 TTGGAGGGAAAGGAAGAGGAAGG + Intergenic
1005161163 6:22865724-22865746 TTGAGGACACAGCAAGAGGATGG - Intergenic
1005250013 6:23934685-23934707 GTGAAGGCAAAGCAGGAGCAGGG + Intergenic
1005257309 6:24016701-24016723 TCAGAGGCACGGCAAGATCATGG - Intergenic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007853467 6:44829129-44829151 TTGGAGGAACAGGAAAAGGAGGG + Exonic
1008628767 6:53344263-53344285 TTTGAGGGCCAGCAAGAGGAGGG - Intronic
1008893661 6:56526246-56526268 TTGGAAGCACAGCAAATGAATGG + Intronic
1011841469 6:91505920-91505942 TTGGACCAACAGCAAGAACAAGG - Intergenic
1012409663 6:98942571-98942593 TGGCAGGCAAAGCAGGAGCAAGG - Intronic
1013300870 6:108803868-108803890 CTGGTGACCCAGCAAGAGCAAGG + Intergenic
1013659412 6:112279641-112279663 TTGGAGAAACAGCTAAAGCAAGG + Intergenic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015988894 6:138914714-138914736 TTGGAGGCACTGCAGGAGGATGG + Exonic
1016811970 6:148270107-148270129 TTGCTGGGACAGCAAGAGGATGG + Intergenic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1018928142 6:168221628-168221650 TTGGTGGCCCAGCAAGGCCAGGG - Intergenic
1020929201 7:14372056-14372078 TTGGAGGCGCTGAAAGAGAAAGG - Intronic
1023198258 7:37665517-37665539 TTGGAGGCAGTGCAGGAGCCGGG + Intergenic
1023205854 7:37749198-37749220 AGGGAGGCAAAGCAATAGCATGG - Intronic
1023464557 7:40439757-40439779 CTGAAAGCACAGCATGAGCATGG - Intronic
1024137021 7:46419724-46419746 TTGGAGATACAGCAATAACAGGG + Intergenic
1024202119 7:47118300-47118322 TTGCAGGACCAGCAAGAGAATGG - Intergenic
1024317369 7:48034028-48034050 TGGGCGACAGAGCAAGAGCAAGG + Intergenic
1024644043 7:51356484-51356506 ATGGAGACAAAGCCAGAGCAGGG - Intergenic
1024719542 7:52119773-52119795 TTGCAGGCACAGTCACAGCAAGG - Intergenic
1027983933 7:85261129-85261151 TTGGAAGGACCACAAGAGCAAGG - Intergenic
1029515573 7:101021076-101021098 TGGAAGGCACAGAAAGTGCAAGG - Intronic
1030238755 7:107295894-107295916 TGGGAGGCTGAGCAAGAGAATGG - Intronic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1032422930 7:131797565-131797587 ATGGAGACAGCGCAAGAGCATGG + Intergenic
1032456366 7:132076153-132076175 GTGGAGGGGCAGAAAGAGCATGG - Intergenic
1034039081 7:147857893-147857915 TGTGAGTCACAGCAAGAACATGG + Intronic
1035843067 8:2833323-2833345 TTAGATCCACAGCAAGACCAAGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036768306 8:11562886-11562908 ATGGAAGGACAGCAGGAGCAGGG + Intronic
1037579871 8:20238799-20238821 TTGGAGGCCCAGCCAGATGAAGG + Intergenic
1037785639 8:21901478-21901500 ATGGAGGCACAGACAGGGCATGG - Intergenic
1039640145 8:39210489-39210511 GAGGAGGCAGAGTAAGAGCACGG - Intronic
1039818957 8:41119374-41119396 CTGAATGCACAGCAAGAACAAGG + Intergenic
1039859912 8:41448207-41448229 TTGGAGACCCAGTAAGATCAAGG - Intergenic
1040634584 8:49257418-49257440 TTGGAGTCACAGCATGAAAAAGG + Intergenic
1040734600 8:50490655-50490677 TTGGAGGAACTGCAGGGGCAGGG + Intronic
1041022299 8:53650086-53650108 TTGGAGACAGACCAGGAGCAGGG + Intergenic
1043628747 8:82299318-82299340 TGGGAGGCAGAGTAACAGCAAGG - Intergenic
1043859176 8:85296143-85296165 TTGCAGGCACAACAAGGGGATGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045481690 8:102597868-102597890 ATGGAGTGCCAGCAAGAGCAGGG + Intergenic
1045586197 8:103539911-103539933 TGGCATGCACAGCAAGAGCTTGG - Intronic
1047004457 8:120605211-120605233 TTGGAGGAACAGCAAGAAATGGG + Intronic
1048026299 8:130590198-130590220 ATGGAGGCACAGCCAGATCGTGG - Intergenic
1048329968 8:133464687-133464709 GTGGAGGCACAGCAGGACCACGG + Intronic
1048493301 8:134914214-134914236 TTGGAACCACAGCAAGAGACTGG - Intergenic
1049271128 8:141696863-141696885 TAGGAGGCACAGCCTGTGCAGGG + Intergenic
1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG + Intergenic
1049747151 8:144267798-144267820 TTGGTGGCACCGGAAAAGCAGGG + Intronic
1050427005 9:5521902-5521924 TGGGAGGTACAGCAGGACCAAGG + Intronic
1051083417 9:13319483-13319505 CAGGAGGCAAAGGAAGAGCAAGG + Intergenic
1052540080 9:29799768-29799790 CTGGAAACACAGCAAGATCATGG + Intergenic
1052764531 9:32627216-32627238 TTGAAGGCAGAGAAAGAGAAAGG - Intergenic
1052863966 9:33453804-33453826 TCTGAGGCACAGGGAGAGCAGGG + Intergenic
1053042409 9:34885710-34885732 ATGGAGCCTGAGCAAGAGCATGG - Intergenic
1053428531 9:38026926-38026948 CTGGAAGCAATGCAAGAGCAGGG - Intronic
1053886364 9:42647157-42647179 GTGGAGGTGCAGCCAGAGCAAGG + Intergenic
1054225384 9:62454606-62454628 GTGGAGGTGCAGCCAGAGCAAGG + Intergenic
1056722983 9:89087460-89087482 CTGCAGGCACCCCAAGAGCAGGG - Intronic
1057180391 9:93026708-93026730 CTGGGTGCACAGCAAGAGCTTGG - Intronic
1057388323 9:94623387-94623409 AGGGAGGCTCAGAAAGAGCAGGG - Intronic
1059030603 9:110691311-110691333 TTGGAGGCAAATCATGAGTATGG - Intronic
1060980211 9:127787415-127787437 TGGGAGACAGAGCAAGATCATGG - Intronic
1061868555 9:133507796-133507818 GGGGCGGCACAGCAAGACCAGGG + Intergenic
1061904336 9:133688960-133688982 TTGGACGGACAGCAACAGCTCGG + Intronic
1186404207 X:9287466-9287488 CAGTAGGAACAGCAAGAGCAAGG - Intergenic
1187959893 X:24558589-24558611 AGGGAGGGACAGGAAGAGCACGG - Intronic
1188655980 X:32695846-32695868 TTGGAAGAACAGAAAGAGCCAGG + Intronic
1189328817 X:40130352-40130374 TTGGAGGACCAGGAAGACCAGGG - Intronic
1190337986 X:49274407-49274429 TTGGAGTAACAGAAAGACCATGG - Intronic
1190630060 X:52377621-52377643 TTGCAGGCAAAGTAAAAGCAAGG + Intergenic
1194187313 X:90789387-90789409 TTGCAGGCACAGCAATAGATAGG - Intergenic
1195146067 X:102018487-102018509 TGGGAAGCACAACAAGAGCTTGG - Intergenic
1195594686 X:106674244-106674266 TTGGAGGCAGAGCAGGAGGGCGG - Intronic
1195860853 X:109381235-109381257 TTTTGGGCAAAGCAAGAGCAGGG - Intronic
1195906403 X:109848680-109848702 TTGGAGGAAGAGCTAGAGAAAGG + Intergenic
1197118076 X:122856788-122856810 TTGGACGCATAGCAAAAGCCGGG - Intergenic
1197882838 X:131187441-131187463 TTGGAGGAAGGGCAAGAACATGG - Intergenic
1198409719 X:136354356-136354378 TTGAGGGCACAGCAAGAAGAGGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199683019 X:150240426-150240448 TGGGGGACACAGCAGGAGCAAGG + Intergenic
1200229179 X:154435623-154435645 TGGGAGGCCCAGCAAGAACTGGG - Intronic
1200533907 Y:4371344-4371366 TTGCAGGCACAGCAATAGGTAGG - Intergenic