ID: 1130709376

View in Genome Browser
Species Human (GRCh38)
Location 15:86264733-86264755
Sequence CTTGAAGTCCACCACAGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130709376_1130709378 1 Left 1130709376 15:86264733-86264755 CCAGCTCTGTGGTGGACTTCAAG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1130709378 15:86264757-86264779 TGATGGCATTTCCTGATGTCTGG 0: 1
1: 0
2: 2
3: 23
4: 202
1130709376_1130709379 2 Left 1130709376 15:86264733-86264755 CCAGCTCTGTGGTGGACTTCAAG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1130709379 15:86264758-86264780 GATGGCATTTCCTGATGTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 178
1130709376_1130709380 3 Left 1130709376 15:86264733-86264755 CCAGCTCTGTGGTGGACTTCAAG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1130709380 15:86264759-86264781 ATGGCATTTCCTGATGTCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130709376 Original CRISPR CTTGAAGTCCACCACAGAGC TGG (reversed) Exonic
902081647 1:13824987-13825009 CTTGAAGACCACCACTGACCAGG - Exonic
907948958 1:59162356-59162378 CTAGAGGGCCACCACAGATCTGG + Intergenic
908477516 1:64504754-64504776 CTTGCAGTCCACCTCAAAGTAGG - Intronic
913051785 1:115123023-115123045 TTTGAAGGTTACCACAGAGCTGG - Intergenic
913084557 1:115424778-115424800 CTGGAAGGCCACAGCAGAGCAGG - Intergenic
916162241 1:161929287-161929309 CCTAAATTACACCACAGAGCTGG + Intronic
917917273 1:179715267-179715289 CTTTAAGTCCTCCCCAGAACAGG - Intergenic
918181524 1:182088886-182088908 TTTGAATTCTAGCACAGAGCTGG + Intergenic
919555540 1:199047702-199047724 CTTAAAGTCAACCAGAGAGAAGG + Intergenic
923354531 1:233140927-233140949 CATGAAGCCCACAGCAGAGCTGG - Intronic
924155839 1:241175669-241175691 AGGGAAATCCACCACAGAGCAGG + Intronic
1062803043 10:394318-394340 CTTCCAGTTCAGCACAGAGCAGG - Intronic
1062949902 10:1490947-1490969 CTTGAAGTCCACATCATGGCAGG + Intronic
1063633130 10:7753535-7753557 CATGAAGTCCAGCACATAGTAGG - Exonic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1068061534 10:52073640-52073662 CTGGAAGTCCAGCACAGCACAGG + Intronic
1068713204 10:60156469-60156491 CTTGTAGCCCAGCACAGTGCTGG - Intronic
1070784109 10:79153266-79153288 CTTGTAGTCCATCACTGGGCTGG + Intronic
1073850109 10:107605469-107605491 TTTCAAGGCTACCACAGAGCTGG - Intergenic
1076377793 10:130003185-130003207 CTTGCAGTCCACGACACATCTGG - Intergenic
1076630368 10:131848693-131848715 CTAGAAGTCAACTCCAGAGCTGG - Intergenic
1077094180 11:792428-792450 CGGGAAGTACACCACAGAGAAGG + Exonic
1077474864 11:2781543-2781565 CCTGAAGTCCCACACAGGGCTGG + Intronic
1079343215 11:19630021-19630043 CCAGAAGTTCACCACAGAGTTGG - Intronic
1079343224 11:19630064-19630086 CCAGAAGTTCACCACAGAGTTGG - Intronic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084522006 11:69669059-69669081 CTTGGACTCCAGCACAGAGTAGG + Intronic
1086981472 11:93202983-93203005 CTTGAAATCAACTACAGAGCAGG - Intergenic
1091002815 11:131924681-131924703 CTTGAATGACAGCACAGAGCAGG + Intronic
1092880643 12:12885463-12885485 CTTAAAGTCCATCCCAGAGAAGG + Intergenic
1095945644 12:47751814-47751836 CTCTAAGGCCTCCACAGAGCGGG - Exonic
1096970604 12:55663280-55663302 TTTCAAGGCCACCATAGAGCTGG + Intergenic
1108102930 13:46976967-46976989 CTGGAAATCTACTACAGAGCAGG - Intergenic
1109664274 13:65510440-65510462 CCTGAAGTCCAACTCAAAGCAGG + Intergenic
1109862497 13:68218516-68218538 CTTGAGGTCCCTCACATAGCAGG - Intergenic
1112045947 13:95597942-95597964 CTTAAAGACCACCACAGCCCAGG - Intronic
1112462021 13:99611099-99611121 TTTCAAGTCTACCACAGAGCTGG + Intronic
1112657990 13:101473607-101473629 CTCCAAGCCCAGCACAGAGCAGG - Intronic
1114032112 14:18586999-18587021 CTTGGTGTCCACCAGAGACCTGG + Intergenic
1114645912 14:24256037-24256059 CTTGATGGACTCCACAGAGCAGG + Exonic
1115518946 14:34213575-34213597 CTTGAAGTCAATCAGAAAGCAGG + Intronic
1116516393 14:45811622-45811644 CTTGAATTCCACCACAGGTTAGG - Intergenic
1119643557 14:76331615-76331637 CTTGAAGGACAACAGAGAGCTGG + Intronic
1120374838 14:83690975-83690997 TTTTAAGTCTACCACTGAGCTGG + Intergenic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1122368438 14:101213235-101213257 TTTCAAGTCTACCACAGGGCTGG + Intergenic
1126535396 15:49756674-49756696 TTCTAAGGCCACCACAGAGCTGG - Intergenic
1127904868 15:63368965-63368987 CCTGAAGTCTCCCAGAGAGCAGG - Intronic
1128854738 15:71000052-71000074 CTTCAAGGCCACCACCAAGCTGG + Intronic
1130437582 15:83916816-83916838 CATGGAGTCTAACACAGAGCAGG - Intronic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1131522496 15:93126971-93126993 CTTGAAGGCCACAGCGGAGCAGG + Intergenic
1135675208 16:24409227-24409249 CTTGACATCCAGCAGAGAGCAGG + Intergenic
1137773714 16:51039072-51039094 CCTGAGGACCCCCACAGAGCTGG - Intergenic
1139384774 16:66559397-66559419 CTTGATGTACACTTCAGAGCTGG + Intronic
1143744843 17:8985098-8985120 TTTCAAGTCTACCTCAGAGCTGG - Intergenic
1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG + Intronic
1148855740 17:50578428-50578450 CCAGAAGGCCAGCACAGAGCTGG - Exonic
1152742694 17:82025269-82025291 CTTGCAGTCATCAACAGAGCAGG - Intronic
1160113781 18:76058179-76058201 CTTGAGGCCCATCACCGAGCAGG + Intergenic
1161629683 19:5346698-5346720 CATGGAGCCCAGCACAGAGCAGG - Intergenic
1161685155 19:5698860-5698882 CCTGAAGTCCGCCACATGGCTGG + Intronic
1162718477 19:12648119-12648141 ATTGAAGTCTACCAGGGAGCCGG - Intronic
1164487003 19:28667059-28667081 CTGGAAGTCAAACCCAGAGCAGG - Intergenic
1164593140 19:29517113-29517135 CTCGAAGGCCAGCACAGGGCTGG - Intergenic
1165070644 19:33253249-33253271 CTTGGGGTCCACCCCAGGGCAGG - Intergenic
1165091329 19:33389736-33389758 CTTGAGGTCCACCACTGAAGTGG + Intronic
1167821647 19:51933694-51933716 CTTTAAGACCATCACTGAGCTGG + Intronic
926387344 2:12349783-12349805 CATGAAATCCAGCACAGTGCTGG - Intergenic
928007150 2:27573098-27573120 GTTGAAATCCTCCACAGAGTCGG + Intergenic
940879192 2:158929469-158929491 CTTAAAGTCCAGCTCAGAGGTGG + Intergenic
946813725 2:223554157-223554179 CTTGAAATCGACCACAGTGAGGG - Intergenic
947013648 2:225593192-225593214 CTTGAAGTCTAGCACAAGGCTGG + Intronic
947539993 2:230969792-230969814 CTTGAAGTCCATCAGGGACCAGG + Intergenic
948325371 2:237115376-237115398 CTTTATGTCCACCACTGAGTGGG - Intergenic
1168813996 20:724165-724187 CTTGGTGCCCACCACACAGCAGG + Intergenic
1169088034 20:2839372-2839394 GTCTAAGTCAACCACAGAGCTGG - Intronic
1169395328 20:5223995-5224017 CAGGAACTGCACCACAGAGCTGG - Intergenic
1169967980 20:11238369-11238391 CTTGAAGTTAAACAAAGAGCTGG - Intergenic
1170671932 20:18442043-18442065 CTAGAAGCCCAGCTCAGAGCAGG + Intronic
1171302093 20:24072034-24072056 TTTCAAGGCTACCACAGAGCTGG + Intergenic
1172092614 20:32444885-32444907 CTTGGAGGGCACCAAAGAGCTGG - Exonic
1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG + Intergenic
1172803191 20:37592636-37592658 CATGAAGTTCGGCACAGAGCAGG - Intergenic
1180220876 21:46357014-46357036 CTTGGAGGCCGACACAGAGCGGG + Exonic
1180456226 22:15514056-15514078 CTTGGTGTCCACCAGAGACCTGG + Intergenic
1181237327 22:21455626-21455648 CAGGAAGCCCCCCACAGAGCAGG + Intergenic
1182144741 22:27990537-27990559 CCTGAGGTCCACCAGACAGCAGG - Intronic
1184715444 22:46279337-46279359 CATGAAGTGCCACACAGAGCCGG - Intronic
949147739 3:723293-723315 CTTAAAGTCCACAACAAATCAGG - Intergenic
949388303 3:3530290-3530312 CTTGAAGTCCACCAACAAGGTGG - Intergenic
950027354 3:9829293-9829315 CTTGCACGCCAGCACAGAGCCGG - Exonic
950197627 3:11020298-11020320 CCAGAACTCCACCACAGCGCTGG - Exonic
950506340 3:13397157-13397179 CTTGAGGCCCACCTCAGAGGTGG + Intronic
959115847 3:102177402-102177424 ATTGCATTCCACCACAGAACTGG - Intronic
960085447 3:113585697-113585719 CTTGAGGTGCAACAAAGAGCAGG + Intronic
962010990 3:131390632-131390654 CCTGATGTCCACCACACAGCAGG + Intergenic
962613136 3:137097884-137097906 CCTGAAATCCACTCCAGAGCAGG - Intergenic
964130459 3:153281180-153281202 CTTGCAGCCCAACACAGGGCAGG + Intergenic
964354291 3:155835780-155835802 CTTGCATTTCACCACAGATCTGG + Intronic
966465269 3:180224847-180224869 CTTGAAGGTCTCCACAGAGGTGG - Intergenic
970156599 4:13148618-13148640 CTTGAAGGACAGCAAAGAGCTGG + Intergenic
971840542 4:31846693-31846715 CTTCAAGGCCACCATTGAGCTGG - Intergenic
977588733 4:98803572-98803594 CATGAATTGCACCACAGAGTTGG - Intergenic
979050695 4:115927903-115927925 CTTGGAGTGTACCACAGAGATGG + Intergenic
982549497 4:156779914-156779936 AGTCAACTCCACCACAGAGCAGG + Intronic
982841604 4:160194823-160194845 CTTGCCGACCTCCACAGAGCTGG - Intergenic
985145446 4:186890306-186890328 CAAGAAATCCAGCACAGAGCCGG - Intergenic
985924308 5:3004172-3004194 CTCGAAGCCCACCCCAGACCAGG + Intergenic
986970606 5:13331967-13331989 CTTGGTTTCCACCACACAGCTGG - Intergenic
988602501 5:32652812-32652834 ATTGAAGACCACCACAAAACAGG - Intergenic
989331029 5:40258506-40258528 TTTCAAGGCTACCACAGAGCTGG + Intergenic
990475995 5:56162329-56162351 CTAGAAGTCAGCCTCAGAGCAGG - Intronic
992491833 5:77252167-77252189 CTGACAGTCCACCCCAGAGCTGG + Intronic
994323101 5:98415761-98415783 CTTAAAGTCCACCATTGACCTGG - Intergenic
999049781 5:148509926-148509948 GTAGAAGGCCACCACAGAGCAGG + Exonic
1000167000 5:158659812-158659834 TTTCAAGGCTACCACAGAGCTGG - Intergenic
1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG + Exonic
1006437921 6:34035920-34035942 CTGGAAGTCCACCACCGAGTGGG + Exonic
1007700147 6:43761668-43761690 TTGGAATTCCACCCCAGAGCTGG + Intergenic
1007851039 6:44803072-44803094 CATGCAGTCCATCACAGAGAGGG + Intergenic
1008140566 6:47827289-47827311 TTTGAAGTTCATTACAGAGCTGG + Intronic
1008636693 6:53417974-53417996 TTTTAAGTCCATCATAGAGCGGG + Intergenic
1009188416 6:60600705-60600727 CTGGAGGTCCACTACAGACCAGG - Intergenic
1012578705 6:100836258-100836280 CTTGAAGTCCTAGCCAGAGCAGG - Intronic
1016935647 6:149447487-149447509 CATGAAGCCCACCAAAGTGCTGG + Intergenic
1017599489 6:156064899-156064921 CCTGCAATCCAGCACAGAGCAGG + Intergenic
1017766321 6:157610006-157610028 ATTGAAGTTCATCACAGAGGGGG + Intronic
1018581280 6:165310327-165310349 CTGGAGGTCCAGCACAGAGTAGG + Intergenic
1022425730 7:30267061-30267083 TTTCAAGGCTACCACAGAGCTGG + Intergenic
1023618032 7:42040744-42040766 CTTTAAGTATACCATAGAGCAGG - Intronic
1023635465 7:42205131-42205153 CTTTAAGAACACCACATAGCAGG - Intronic
1025078072 7:55960444-55960466 CTTGGACTCCATCCCAGAGCTGG - Intronic
1028637569 7:93006660-93006682 CTTGAAGTTGACCAAACAGCAGG + Intergenic
1029715326 7:102322332-102322354 GTTTAAGTCTACCACCGAGCTGG - Intergenic
1034295643 7:149969923-149969945 CTTGAAATCCCCCAAGGAGCTGG + Intergenic
1034810418 7:154126982-154127004 CTTGAAATCCCCCAAGGAGCTGG - Intronic
1036791617 8:11725022-11725044 CGTGAAGGCCACCCCTGAGCGGG - Intronic
1039961601 8:42252297-42252319 CATGCATTCCACCACAGAACCGG + Intergenic
1043051769 8:75394019-75394041 CTTGCAGACCACCAAAGACCGGG - Intergenic
1046033837 8:108817119-108817141 CCTGAAATCTCCCACAGAGCAGG - Intergenic
1047519348 8:125582635-125582657 CATGAATGGCACCACAGAGCTGG + Intergenic
1048081139 8:131128564-131128586 CATGATGTCCAACACACAGCAGG + Intergenic
1059757650 9:117308800-117308822 TATGAAGTCCAGCACAGAGAAGG - Intronic
1062347738 9:136123134-136123156 CTTAAAGTCTCCCACAGACCTGG - Intergenic
1192065042 X:67874793-67874815 CTGGAAGTCCTAGACAGAGCAGG - Intergenic
1192129819 X:68539006-68539028 CTTGATGACAACCACAGTGCTGG + Intergenic
1194054892 X:89119612-89119634 TTTGAAGTCCATCACATTGCTGG + Intergenic
1195063901 X:101221648-101221670 CTTCAAGTCCACCATAAAGGAGG + Intronic
1199461237 X:148087815-148087837 TTTCAAGGCTACCACAGAGCTGG - Intergenic
1199526554 X:148798838-148798860 CTTGAGATGCTCCACAGAGCTGG + Intronic
1199784060 X:151088613-151088635 CTGGAAGTCAAGGACAGAGCGGG - Intergenic
1199944210 X:152652630-152652652 TTTGACGTCCACCTCCGAGCAGG + Exonic