ID: 1130714490

View in Genome Browser
Species Human (GRCh38)
Location 15:86318298-86318320
Sequence GCCACTAGTGTGTCTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130714487_1130714490 10 Left 1130714487 15:86318265-86318287 CCCACTATCCATGTTAACATAAA 0: 1
1: 0
2: 0
3: 17
4: 192
Right 1130714490 15:86318298-86318320 GCCACTAGTGTGTCTCTCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 93
1130714486_1130714490 18 Left 1130714486 15:86318257-86318279 CCTATTTGCCCACTATCCATGTT 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1130714490 15:86318298-86318320 GCCACTAGTGTGTCTCTCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 93
1130714488_1130714490 9 Left 1130714488 15:86318266-86318288 CCACTATCCATGTTAACATAAAG 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1130714490 15:86318298-86318320 GCCACTAGTGTGTCTCTCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 93
1130714489_1130714490 2 Left 1130714489 15:86318273-86318295 CCATGTTAACATAAAGTAGAACA 0: 1
1: 0
2: 2
3: 19
4: 253
Right 1130714490 15:86318298-86318320 GCCACTAGTGTGTCTCTCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130714490 Original CRISPR GCCACTAGTGTGTCTCTCCC AGG Intronic
901957476 1:12797138-12797160 GCCACTTGTGCTTCTCACCCTGG - Intergenic
907945158 1:59129217-59129239 GGCTCTTGTGTGTCTCTGCCTGG + Intergenic
908574115 1:65441237-65441259 ACCACTTGAGTGTCTGTCCCTGG + Intronic
909791181 1:79680182-79680204 GCCACCTGTGTGACTCTCCTAGG - Intergenic
914006650 1:143738199-143738221 ACCACTTGACTGTCTCTCCCGGG - Intergenic
914516721 1:148380421-148380443 GCCACTGGTGTGTTTCTACAGGG + Intergenic
920193186 1:204208146-204208168 CCCACTACTGGGTATCTCCCCGG + Intronic
920368603 1:205462533-205462555 GCCATTCCTCTGTCTCTCCCTGG + Intergenic
922084758 1:222335629-222335651 GCCACATGTCTTTCTCTCCCAGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1067066641 10:43107502-43107524 GGCTCTAGTGTGTCCTTCCCAGG + Intronic
1070600688 10:77864345-77864367 GCCACTGCTTTGCCTCTCCCGGG - Intronic
1072549513 10:96466683-96466705 CCCACTAGTGGGTCTCTGCAAGG + Intronic
1073194536 10:101678400-101678422 GAAATTAGTGTATCTCTCCCTGG - Intronic
1077378497 11:2216545-2216567 GCCACAAGTGTGTCTATGCCGGG - Intergenic
1081874110 11:46397212-46397234 GCCCACAGTGTGGCTCTCCCGGG + Exonic
1083466115 11:62847405-62847427 GCCACCAGTGTTTCTTTCCCAGG - Intergenic
1084609517 11:70193305-70193327 GCCACCAGTGTGTCATTGCCAGG - Intergenic
1085416570 11:76322273-76322295 GCCACACCTGCGTCTCTCCCAGG - Intergenic
1085986026 11:81789570-81789592 CCCACTAGTGGGTATCTGCCCGG + Intergenic
1088319159 11:108536992-108537014 GCCATTAGTCAGTCCCTCCCAGG + Intronic
1090467225 11:126945308-126945330 GCCACAAGTGTGGCTCTGACAGG + Intronic
1091787167 12:3250138-3250160 GGCCCTTGTGTCTCTCTCCCTGG + Intronic
1102079997 12:110090341-110090363 GCCAATAGTCTGGCTCTCCTGGG - Intergenic
1106298003 13:28435702-28435724 GCCACTAGTGCCTCTCTTCCAGG + Intronic
1110211329 13:72977006-72977028 GCCGCTAGCTTGTCTCACCCTGG + Intronic
1112828694 13:103422350-103422372 GGCATTTGTGTGTCTCTTCCTGG + Intergenic
1115753631 14:36513914-36513936 GCCACTAGAGCGGCTCTCCAAGG + Intergenic
1119991491 14:79202883-79202905 GCCACTACTGGGTATCTACCCGG - Intronic
1126477396 15:49079832-49079854 GCCGCTAGCGTGTTTATCCCTGG + Intergenic
1129452083 15:75656808-75656830 GCCACCTGGGTGTCTCTGCCAGG - Intronic
1129898443 15:79126357-79126379 GCCATTAGAGTGTCCATCCCCGG - Intergenic
1130714490 15:86318298-86318320 GCCACTAGTGTGTCTCTCCCAGG + Intronic
1133332446 16:4982870-4982892 GCCATTAGAGGGTCTCACCCTGG - Intronic
1135178836 16:20255477-20255499 CCCACAATTGTGTCTCACCCTGG + Intergenic
1135399467 16:22156243-22156265 GCCACTAGATTGTCCCTCTCTGG + Exonic
1136710694 16:32234392-32234414 GCCCCTAGTGCCTCTCTCCTGGG + Intergenic
1139114407 16:63932142-63932164 GCCACTAGTGTGTCTCTTTTAGG + Intergenic
1139377742 16:66510967-66510989 GCCACTTGTGTCTCTCTCTTGGG + Exonic
1141633992 16:85304083-85304105 GTCCCTGGTGTGTCTCTCCATGG + Intergenic
1141878547 16:86842623-86842645 GCCAGCAGGGTGTCTCTCTCTGG - Intergenic
1143439085 17:6954230-6954252 GCCCTCAGTGTGTCTCTCCCTGG + Intronic
1143616762 17:8056100-8056122 GCCACTTTTGTCTCTGTCCCAGG - Intergenic
1145920613 17:28606560-28606582 GTCACTAGGGTCTCTCTCCTAGG - Intronic
1146392361 17:32434384-32434406 GCCATTAGGGTGTATTTCCCAGG - Intergenic
1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG + Intergenic
1151114329 17:71716922-71716944 GCCAATAGCCTGTCTCTCCTGGG - Intergenic
1151186599 17:72369353-72369375 GCCAATGGCGTGTCTCTCCAGGG - Intergenic
1151711668 17:75810446-75810468 GTCATTAGTGTGACACTCCCAGG - Intronic
1156581306 18:38379747-38379769 GCCACCTCTGTGTCTCTCCTGGG + Intergenic
1160303053 18:77704020-77704042 GCCACAAGGGTGCCTTTCCCTGG - Intergenic
1160542993 18:79635240-79635262 GCCGCTCAGGTGTCTCTCCCAGG - Intergenic
1162231764 19:9272445-9272467 GCCACAAGTGAATCTCTTCCTGG + Intergenic
1164617495 19:29675736-29675758 GCCATTTGTGTGGCTCTGCCGGG + Intergenic
1166193783 19:41193484-41193506 GGCACTCGGGTTTCTCTCCCAGG - Intronic
1168314519 19:55478696-55478718 GGCACCACTGTCTCTCTCCCAGG - Intronic
926821394 2:16855154-16855176 GCCACTAGTGTGCCTTGGCCCGG + Intergenic
926993289 2:18703705-18703727 GCCAAGAGTGTGTCTATTCCAGG - Intergenic
937093664 2:119222880-119222902 GCTAATAGTGTATGTCTCCCAGG + Intergenic
939002266 2:136749965-136749987 GTCACTAGTTTGAGTCTCCCTGG - Intergenic
940853186 2:158707348-158707370 TCCACAAGTGTGTCTCTGCCAGG - Intergenic
941206453 2:162579291-162579313 GCCACTTTTTAGTCTCTCCCGGG + Intronic
944684971 2:202110071-202110093 TCCAGTAGTGTGTCTCCCCCAGG - Intronic
1170791434 20:19512412-19512434 GCCTCCAGTGTGTCTTCCCCAGG + Intronic
1172694855 20:36815524-36815546 GGGACTCGTGTGTCTCGCCCAGG + Exonic
1172921817 20:38489850-38489872 GGCCCTAGTGTTTCTCTTCCTGG + Intronic
1177653148 21:23983589-23983611 GCCACTTCTCTGACTCTCCCAGG + Intergenic
1178349353 21:31861188-31861210 CCCAGTAGCGTGTCTCTTCCAGG - Intergenic
1181025893 22:20127482-20127504 GACACCAGGGCGTCTCTCCCAGG - Intergenic
1181636251 22:24176205-24176227 GCCAGCAGTGTGGCTCTGCCGGG - Exonic
950136757 3:10586553-10586575 GGCACTAGTCTGTCTCCCCAGGG + Intronic
950521138 3:13498740-13498762 GGCACTGGTCAGTCTCTCCCAGG - Intronic
954856366 3:53647262-53647284 GCCACAGGTGTGACTCTGCCTGG + Intronic
956027448 3:64998491-64998513 GCTACTCATGTGTCTCTCACTGG + Intergenic
978158803 4:105520941-105520963 GCCTCTCTTGTCTCTCTCCCTGG + Intergenic
979098536 4:116583914-116583936 GCCACCAGTGTTTCTATCCCAGG + Intergenic
980832770 4:138151872-138151894 GCCATTATTGTGTCTATCACAGG - Intergenic
983939500 4:173525315-173525337 GCCTCTAGCTTGTCTCTCCCTGG + Intronic
985080716 4:186261490-186261512 GACACTGGTGTTTCTCTGCCCGG + Intergenic
986788527 5:11138398-11138420 GCCACTATTCTGTCAATCCCAGG + Intronic
993366841 5:87044269-87044291 TCCACTAATTTTTCTCTCCCAGG + Intergenic
994346724 5:98696468-98696490 GCCACAGGTGTGTACCTCCCTGG - Intergenic
996757446 5:126949618-126949640 GCCACATGTCTGTCTCTCCAGGG - Intronic
999767532 5:154752977-154752999 GGCCCTAGTTTGTCTCTCTCTGG + Intronic
1000803339 5:165756950-165756972 GTCACTAATATGTCACTCCCTGG - Intergenic
1006218024 6:32462356-32462378 TACACTAGTGGGTCTCACCCAGG - Intergenic
1006518160 6:34556008-34556030 GCCACTGGCGTGTCTCAGCCAGG + Exonic
1019189820 6:170245418-170245440 GCTCCTCGTGTGTCTCTGCCAGG - Intergenic
1019557350 7:1639309-1639331 GCCATCTGTGGGTCTCTCCCTGG + Intergenic
1019776814 7:2916477-2916499 GCCACTTGTTTGTGTCTACCTGG + Intronic
1028966853 7:96811750-96811772 GCCACAGCTGTGTTTCTCCCTGG + Intergenic
1034224703 7:149473684-149473706 TCCCCTAGTGTGTGACTCCCTGG - Exonic
1035350476 7:158242087-158242109 GCCACTAGCATGGCTCTACCGGG - Intronic
1036716363 8:11127813-11127835 GCCATTAATGTGTCTACCCCAGG + Intronic
1041643656 8:60229482-60229504 CCCACTAGTCAATCTCTCCCAGG + Intronic
1047657802 8:126997879-126997901 CCCACTACTGTGTATCTACCTGG - Intergenic
1049658167 8:143808004-143808026 GGCACCAGTGTGTCCCTCCCTGG - Intronic
1050745779 9:8874402-8874424 GCCACTTTCCTGTCTCTCCCAGG - Intronic
1052041229 9:23741389-23741411 GCCACTAAGGTGACTGTCCCTGG - Intronic
1057271829 9:93655912-93655934 GCCACTCCTGTCTCTCTCCCAGG + Exonic
1188053886 X:25519324-25519346 GCCACTGGTGACTCTCTCCATGG + Intergenic
1190191022 X:48277478-48277500 GCCACTACTGTATCTCCTCCAGG + Intronic
1192368235 X:70492873-70492895 ACCACTCGTGGGTGTCTCCCTGG + Intronic
1195505058 X:105647080-105647102 GCGACTAGTGTTTAGCTCCCGGG + Intronic
1197793261 X:130276477-130276499 GCCAGTAGAATGTATCTCCCAGG + Intergenic