ID: 1130715571

View in Genome Browser
Species Human (GRCh38)
Location 15:86330110-86330132
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 2, 1: 0, 2: 6, 3: 71, 4: 554}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130715571_1130715578 -3 Left 1130715571 15:86330110-86330132 CCCTGCCCACTGTGGCTGCTGCC 0: 2
1: 0
2: 6
3: 71
4: 554
Right 1130715578 15:86330130-86330152 GCCTCCCTGGGAGCTGAGCAGGG 0: 1
1: 0
2: 13
3: 56
4: 484
1130715571_1130715577 -4 Left 1130715571 15:86330110-86330132 CCCTGCCCACTGTGGCTGCTGCC 0: 2
1: 0
2: 6
3: 71
4: 554
Right 1130715577 15:86330129-86330151 TGCCTCCCTGGGAGCTGAGCAGG 0: 1
1: 1
2: 8
3: 63
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130715571 Original CRISPR GGCAGCAGCCACAGTGGGCA GGG (reversed) Intronic
900094146 1:933571-933593 GGCAGTAGCCACAGCTGCCATGG - Intronic
900280368 1:1863423-1863445 GGCAGCAGCCACAGTGGGCAAGG - Intronic
900470970 1:2854795-2854817 GGGAGCACCCACGGTGTGCAGGG + Intergenic
900660354 1:3778969-3778991 GGCAGATGCCACAGTTGGCCAGG - Exonic
900714906 1:4138016-4138038 GCCAGCAGGAACAGTGGGGAAGG - Intergenic
900762549 1:4482744-4482766 GGGAGTCGACACAGTGGGCACGG + Intergenic
900823127 1:4905356-4905378 GCGGGCAGCCACGGTGGGCATGG - Intergenic
901011670 1:6206000-6206022 GGCAGCAGCCACCCTGGGGAAGG + Intronic
901046103 1:6396635-6396657 GGCAGAAGCTGCAGTGAGCAGGG - Intergenic
901078664 1:6571361-6571383 GGCAGGAACCACGCTGGGCAGGG - Intronic
901225862 1:7612658-7612680 GGCAGGGGTCACAGTGTGCATGG + Intronic
901633412 1:10658796-10658818 GGCTGCAGCCCCCTTGGGCACGG + Intronic
902375071 1:16026726-16026748 GGCAGCGGCGGCAGTGGGCGTGG + Exonic
902380042 1:16048533-16048555 GGCAGCGGCGGCAGTGGGCGTGG + Exonic
902568342 1:17330660-17330682 GCCAGAAGCCCCAGTGAGCAAGG + Intronic
903179972 1:21600294-21600316 TGCAGGAGCCAGAGTGGGGAGGG - Intronic
903322561 1:22551777-22551799 GGCTGGAGCCACAGTGGTCACGG + Intergenic
903350769 1:22715341-22715363 GCCAGCAGCCACTGTGTGCTAGG + Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903790840 1:25891860-25891882 GGCAGGAGGAACACTGGGCAGGG + Intronic
903932375 1:26870253-26870275 GGAAGGAGCCACAGTGGCCTTGG - Intergenic
904254901 1:29248640-29248662 AGCTGCAGCCGCATTGGGCATGG + Intronic
904547450 1:31286781-31286803 GAGAGCATCCACACTGGGCAGGG - Intronic
904608885 1:31714593-31714615 GGTAGCAGCCACAGCCGGGAAGG - Intergenic
905267359 1:36764033-36764055 AGGAGCAGTCACAGTGGGGAAGG + Intergenic
905403052 1:37716896-37716918 GGCACCATCCACAGTGCCCAGGG - Exonic
905694966 1:39967426-39967448 GGCAGCAGACAAGGTGGGCCTGG + Intronic
905825400 1:41022631-41022653 GGCAGCAGCCAGGTTGGGCTCGG + Exonic
906079048 1:43071569-43071591 AGCAGCAGCCACAGGGGCTAAGG + Intergenic
906963620 1:50435141-50435163 GGCAGAGGACACAGTGTGCAAGG + Intergenic
907284569 1:53371456-53371478 GGCAGCAGCCTCACCTGGCAGGG + Intergenic
908931008 1:69315845-69315867 GGCAGCAGCAGCAGTGCACAGGG + Intergenic
909249109 1:73328417-73328439 GAAAGAAGCCACAGTGGGGATGG + Intergenic
909364099 1:74799343-74799365 GGCTGGAGCCAGAGTGGGCCTGG + Intergenic
909386904 1:75068169-75068191 TGCATCCACCACAGTGGGCAGGG + Intergenic
910287298 1:85569923-85569945 GTCAGCAGTCACTGTGAGCATGG - Intronic
910492371 1:87786677-87786699 GGCTGCAGCCAGGGTGGGAATGG + Intergenic
910791393 1:91054752-91054774 GGCAGCAGCCAGATGGTGCAGGG + Intergenic
912301865 1:108526107-108526129 GGCAGGTGCCTCAGAGGGCAGGG + Intergenic
912722845 1:112034643-112034665 CCCAGCAGTCACAGTGGACATGG + Intergenic
912799149 1:112710494-112710516 GGTAGCTGCCACTGTGGACAGGG - Exonic
913131620 1:115842783-115842805 GGCAGCTGCTACAGTGGGAAAGG + Exonic
913676591 1:121146711-121146733 GGCAGCAGTGACAGTAGCCAGGG - Intergenic
914028487 1:143934661-143934683 GGCAGCAGTGACAGTAGCCAGGG - Intergenic
914241711 1:145857259-145857281 GGAAGCAGCCAGAGTGGGGCAGG + Intronic
914827082 1:151144352-151144374 GGCAGCAGCTCCTGAGGGCAGGG - Intronic
915524661 1:156468266-156468288 GGCAGCACCCACGTGGGGCAGGG + Exonic
915626190 1:157115453-157115475 GACAGCAGCCGGGGTGGGCAGGG - Intergenic
916194803 1:162212818-162212840 GGCAGCAGCCAAAGTTCACAGGG - Intronic
916528663 1:165635099-165635121 GGCAGCAACCTCAGAGGGCGGGG - Intronic
920340745 1:205273792-205273814 TGCTGCAGCCACAGAGGGCCTGG - Intergenic
920463953 1:206165552-206165574 GGCAGCAGTGACAGTAGCCAGGG - Intergenic
921098893 1:211911363-211911385 AGGAGCAACCACTGTGGGCAAGG + Intergenic
921181731 1:212636836-212636858 AGCAGCTGCCACATCGGGCACGG + Intergenic
921219535 1:212963328-212963350 TGCAGTGGCCCCAGTGGGCAGGG - Intronic
921758196 1:218883052-218883074 GGCAGGAGACAGAGTGTGCAAGG + Intergenic
921817997 1:219586043-219586065 GACAGCAGCGTCAGTGGGCCTGG + Intergenic
922466256 1:225847055-225847077 GGCAGCAGCCACACTGCCCGTGG + Exonic
922500776 1:226095480-226095502 GGCAGCAGGGACTGTGGGCAGGG + Intergenic
922719174 1:227891638-227891660 GGCTGCAGCCGCAGTGGCCCAGG + Intergenic
923436892 1:233975728-233975750 GCCAGCACCCAGAGTGGCCACGG + Intronic
923800776 1:237206150-237206172 GGCTCCAGCCACAGTCTGCAGGG + Intronic
924625267 1:245692233-245692255 GGCAGCCGGCACAGGGGACAAGG + Intronic
924644909 1:245868789-245868811 AGTAGCAGCCACAGTGGGATGGG - Intronic
1062939133 10:1408913-1408935 AGCTGCAGCCACAGTGGGTGAGG - Intronic
1062951272 10:1505689-1505711 GGCGGCTGCCACGGTGGGGACGG - Intronic
1063258230 10:4352977-4352999 GGCACCAGCCACACTGAGGAAGG - Intergenic
1067385257 10:45812779-45812801 GGCAGGAGCCAGAGTCAGCATGG - Intergenic
1067684770 10:48459595-48459617 GACACCAGCTCCAGTGGGCAGGG - Intronic
1069886016 10:71624119-71624141 GGCTGCAGGGTCAGTGGGCAGGG - Intronic
1070680321 10:78444407-78444429 ACCATCAGGCACAGTGGGCACGG + Intergenic
1070726199 10:78792820-78792842 GACAGCAGCCACACAGTGCAGGG - Intergenic
1071509934 10:86255060-86255082 AGCAGGAGACACAGTGGGAAAGG - Intronic
1072607879 10:96999273-96999295 GACACCTGCCACATTGGGCAGGG + Exonic
1073890067 10:108091023-108091045 GGCAGTACTCACAGTGGGCACGG + Intergenic
1073945118 10:108741167-108741189 GGCAGCAGCCTGACTGGGCTTGG - Intergenic
1074453269 10:113576494-113576516 GGCAGCAGACACAGTGAGTATGG - Intronic
1074975803 10:118580749-118580771 GTCAGCATCCACAGAGGGCATGG + Intergenic
1075023598 10:118968160-118968182 GGAAGCTGCCAGTGTGGGCAGGG + Intergenic
1075275008 10:121085506-121085528 GGCCACAGCCACAATGGGCGGGG - Intergenic
1076249809 10:128977082-128977104 GGCAGAAGGCACAGTGTGGAGGG + Intergenic
1076496599 10:130901519-130901541 GCCATCAGCCACAGTGGGGAGGG - Intergenic
1076595139 10:131620491-131620513 GGCAGCAGCCAGAAAGGGCCTGG + Intergenic
1076623372 10:131807184-131807206 TGCAGCAGGCACAGAGGGCAGGG + Intergenic
1076935545 10:133566092-133566114 GGCCTCGGCCACTGTGGGCATGG - Intronic
1076999396 11:315161-315183 GGCAACAGCCCCAGCGTGCAGGG - Exonic
1077113749 11:873452-873474 GGCACCAGCCACAGTGAGTGGGG + Intronic
1077132736 11:981800-981822 CACAGCAGCCTCAGAGGGCAAGG - Intronic
1077136608 11:1002649-1002671 GGAAGCAGCAACAGACGGCAAGG - Intronic
1077369007 11:2172862-2172884 GCCAGAAGCCACCCTGGGCAGGG - Intergenic
1077555093 11:3222154-3222176 AGCCTCAGCCACAGTGCGCAAGG + Intergenic
1078141750 11:8698263-8698285 GGCAGGAGGCACAGTTGGCTTGG + Intronic
1078576770 11:12509465-12509487 AACAGCAGCTACAGAGGGCAAGG - Intronic
1079565546 11:21878059-21878081 GTGAGCAGCTACAGTGGCCAAGG + Intergenic
1079825117 11:25181242-25181264 GGTATCAGCCACAGTGCCCATGG + Intergenic
1080873023 11:36253398-36253420 GGCAGCAGACACAGTAGCAAAGG - Intergenic
1080992865 11:37560671-37560693 GGGAGAAGCCAAAGTGGACAGGG + Intergenic
1081412263 11:42773861-42773883 GGCAGGAGCCCCAGGAGGCAGGG - Intergenic
1082617704 11:55381381-55381403 GGCAGTAGCCAGAGTAGCCATGG + Intergenic
1083157328 11:60832190-60832212 GGCAGCCTCTGCAGTGGGCATGG - Intergenic
1083203746 11:61135065-61135087 GGCACCCGCCACAGGGCGCAGGG + Intronic
1083442888 11:62688474-62688496 GCCAGGAGCCACAGAAGGCAGGG + Exonic
1083619522 11:64042039-64042061 GGCAGCGGCCATGGTGGGCCAGG + Intronic
1083717039 11:64583455-64583477 GGCAGCAGCCAAAGCTGGCTGGG - Intergenic
1083735184 11:64676120-64676142 GGCAGCGGGCAGAGAGGGCAGGG + Intronic
1083755253 11:64788742-64788764 GGCAGCAGCCTCCATGGGAATGG + Intergenic
1084189127 11:67491021-67491043 GGCAGCTGCAGCAGTGGGCTTGG - Exonic
1084544518 11:69807977-69807999 AGCATCAGGCACAGAGGGCAAGG - Intergenic
1084771609 11:71346098-71346120 GGCAGCAGGGACAGTGAGCAAGG - Intergenic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085498233 11:76992545-76992567 GACACAAGCCACAGTGGGCATGG - Intronic
1086143458 11:83524532-83524554 GGAGGCAGCCCCAGAGGGCAGGG - Intronic
1086872389 11:92054328-92054350 GCCAGCTGCCACTGTGGCCAAGG + Intergenic
1087637595 11:100719947-100719969 GGCACCAGCCACATTCAGCAGGG - Intronic
1088827187 11:113505977-113505999 GTTAGCAGCCACAGTGGCCCTGG + Intergenic
1089367754 11:117931543-117931565 CCCAGCAGCCACCGTGGGCCTGG - Intergenic
1090385733 11:126356577-126356599 GGAAGCAGCCACAGTAGGTCAGG - Intronic
1090442699 11:126737341-126737363 GGCACAAGGCACAGTGGGCAGGG + Intronic
1090483328 11:127086961-127086983 GGCAGGAGCCACAAAAGGCAGGG - Intergenic
1090784061 11:130032989-130033011 GGCCCCAGCCACAGTGGGGCTGG - Intergenic
1090821896 11:130350080-130350102 GGCAACAGTCACAGAGGCCAGGG - Intergenic
1091032632 11:132204692-132204714 GGCGGCATCCAGAGTGTGCAAGG + Intronic
1091392921 12:136836-136858 GGCAGAAGCCTCTGGGGGCATGG + Intronic
1091568003 12:1662252-1662274 GGCCGCGGCCACAGAGGGCTGGG - Intergenic
1093928752 12:24934236-24934258 GGCAGGAGACACAGTGAGAAGGG - Intronic
1095158905 12:38892203-38892225 GGCACCAGCCAAAGTGGACTAGG - Intronic
1095212461 12:39509975-39509997 GGCAGCAGCAGCAGTGGGTAGGG - Intergenic
1096030354 12:48408884-48408906 GGCAGCAGCAACACTGGGGGAGG - Intergenic
1096829698 12:54304564-54304586 GGAGGCAGCCACAGGGGGCAAGG + Intronic
1097508676 12:60507936-60507958 GGCAGAAACCTCTGTGGGCATGG + Intergenic
1097916357 12:65024400-65024422 GGCCTCAGCCAGGGTGGGCAGGG - Intergenic
1098308320 12:69123412-69123434 GGGATCAGCCAGAGCGGGCAAGG + Intergenic
1098865396 12:75757040-75757062 GAAAGCAGCCCCAATGGGCATGG + Intergenic
1099256928 12:80325793-80325815 AGCAGCAGGCACAGCTGGCAGGG + Intronic
1101434048 12:104650048-104650070 GGCAGAAGTCAGAGAGGGCAGGG + Intronic
1101751668 12:107587105-107587127 GGGAGCACCCACTGTGGGCTGGG + Intronic
1102096521 12:110245728-110245750 AGCAGCAGTCACTGAGGGCAGGG + Intergenic
1102258871 12:111431217-111431239 GGCAGCAGCCACAGCGAGGGAGG - Intronic
1103146488 12:118599544-118599566 GGCAGAGGCCAGAGTGTGCAGGG - Intergenic
1103196915 12:119052207-119052229 GAGAGCAGCCACAGTTGCCACGG - Intronic
1103357526 12:120332617-120332639 GGCAGGAGCCACAGAGGTCTGGG - Intergenic
1103727598 12:123005800-123005822 GTCAGAAGCCACAGTTGGAAGGG + Intronic
1104110224 12:125697809-125697831 GGCTGCAGCCTCACTGGGGAAGG - Intergenic
1104112221 12:125714752-125714774 GGGAGCAGATACTGTGGGCATGG + Intergenic
1104923421 12:132303125-132303147 GGTGACAGCCACAGTGTGCATGG - Intronic
1104946429 12:132416853-132416875 GGCAGCACCCAGTGTGGGAAGGG + Intergenic
1105723054 13:23135204-23135226 GGCTGCAGCCACAGTGAAGAGGG - Intergenic
1105896781 13:24723346-24723368 AGCAGCATCCACAGTGGACAGGG - Intergenic
1106723069 13:32455638-32455660 GGCACCAGCTGTAGTGGGCAGGG - Intronic
1107059080 13:36136116-36136138 GGCAGCTGCAAGAGTGGGCAGGG + Intergenic
1107409771 13:40147877-40147899 GAGAGCAGGCACATTGGGCATGG - Intergenic
1107678010 13:42816936-42816958 GGAAGAAGGAACAGTGGGCAGGG + Intergenic
1108432639 13:50369677-50369699 TGTATCAGACACAGTGGGCAGGG + Intronic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1109345738 13:61113273-61113295 GACAGCAGCTGCAGTGGGGAAGG + Intergenic
1111863166 13:93734363-93734385 AGCTGCAGCCACAGTAGACATGG + Intronic
1111882127 13:93970549-93970571 AGCAGCAGCAACAGTGGGCATGG - Intronic
1112187331 13:97139898-97139920 GGCAGCAGCTGTGGTGGGCAGGG + Intergenic
1112374369 13:98825077-98825099 GGCTGCATCAACAGAGGGCATGG + Intronic
1113641874 13:111963400-111963422 GACAGCAGCCAGAGTGAGCGGGG + Intergenic
1113853377 13:113430644-113430666 AGCAGCAGCCATAGTGGTGATGG + Intronic
1114317667 14:21523258-21523280 GGCAGCAGCCACAGCTGGGAAGG - Exonic
1114673456 14:24426912-24426934 GGCAGCAGTCAGAGTGTGGAGGG + Exonic
1114678231 14:24459958-24459980 GGCCACAGCCACAGTGGAGATGG - Intergenic
1115344033 14:32323138-32323160 AGCAGCATCCACAGTCAGCATGG + Intergenic
1115974341 14:38980652-38980674 GTCAGGAGCCACAGGGGTCAGGG + Intergenic
1117870700 14:60197767-60197789 GACAGCAGCCAGGGTGGCCAAGG + Intergenic
1118348257 14:64955385-64955407 GGAAGGAGCCACGATGGGCACGG - Intronic
1118470374 14:66069610-66069632 GGCAGCAGCCACCCTGGGCTTGG + Intergenic
1118592641 14:67412599-67412621 GGCGGCAGGCACAGTTTGCAGGG + Intergenic
1118616043 14:67575078-67575100 GGCAGAAGCCACAGTTGTCAGGG - Intronic
1119726523 14:76924855-76924877 GGCGGCAGCCACAGGGAGCTGGG - Intergenic
1120042348 14:79768176-79768198 GGCAGCAGCCAGACTGGGGGAGG + Intronic
1120392314 14:83924469-83924491 GGAAGCAGCCATGGTGGGCATGG - Intergenic
1120969287 14:90193856-90193878 GGAAACAGCCAGAGAGGGCAGGG + Intergenic
1121051186 14:90819925-90819947 GGCAGCTGCCAGAGTGGCCCGGG - Intergenic
1121114578 14:91334794-91334816 GGCATCTGCCACCGGGGGCAAGG + Intronic
1121200891 14:92116898-92116920 AGCAGCATCCACAGTGGGTATGG - Intronic
1121250273 14:92494120-92494142 GGAAGCAGCCACAGTTTGGAAGG + Exonic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1121650285 14:95553150-95553172 GGGAGCAACCAGAGAGGGCAAGG - Intergenic
1121654029 14:95581894-95581916 GGGAGGACCCAGAGTGGGCACGG - Intergenic
1122005295 14:98698512-98698534 GCCAGCGGCCACACTGGGAATGG - Intergenic
1122159044 14:99769456-99769478 GGCCTCCCCCACAGTGGGCAGGG + Intronic
1122406586 14:101504575-101504597 GGGAGCAGCCAGAGAGGGAAAGG + Intergenic
1122585772 14:102805514-102805536 AGCAGAAGCCACAGAGGGCTTGG - Intronic
1122880720 14:104689470-104689492 GGGACCGGCCACAGTGGGCGGGG + Intergenic
1122967150 14:105136680-105136702 CCCACCATCCACAGTGGGCAGGG + Intergenic
1123098035 14:105775593-105775615 GGCAGCTGACAGCGTGGGCAAGG - Intergenic
1124441147 15:29687424-29687446 GGCAGCTGCCAGTGTGGGCTGGG + Intergenic
1125197202 15:37060767-37060789 GGCATCAGCTACAGAGTGCAGGG + Intronic
1125767254 15:42144036-42144058 GGCAGCAGAGCCAGTGGGAACGG + Exonic
1125793340 15:42386392-42386414 CGCAGCGGCAACAGTCGGCATGG + Intronic
1126180506 15:45780819-45780841 GGCAGAAGCCAAAGGGGGCAGGG - Intergenic
1126351779 15:47751630-47751652 GGCAGCAGACCCAGGGGGGATGG - Intronic
1128232842 15:66047717-66047739 GGCAGGAGGCCCAGTGGGCCTGG + Intronic
1128737738 15:70062811-70062833 GGCAGAGGCAGCAGTGGGCAGGG - Intronic
1128923658 15:71634504-71634526 AGCTGCAGCCAAAGTGGACATGG - Intronic
1129070453 15:72946290-72946312 GGCAGCAGCAGCAGTGGGCAGGG - Intergenic
1129296787 15:74604236-74604258 AGGAGAAGCCACAGTGGGCTGGG + Intronic
1130651301 15:85763608-85763630 TGCAGAGGCCACAGTGTGCAGGG + Intronic
1130715571 15:86330110-86330132 GGCAGCAGCCACAGTGGGCAGGG - Intronic
1131032724 15:89199954-89199976 GGCAGCAGCAGCAGAGGGGAAGG - Exonic
1131156893 15:90081053-90081075 GGCAGCAGCCTCAGCAGGCTGGG + Exonic
1132090555 15:98945038-98945060 GAGAGCAGCCACAGTGCCCAAGG - Intronic
1132384538 15:101390690-101390712 GCCAACAGCCCGAGTGGGCAAGG + Intronic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1132987495 16:2775463-2775485 GGCCCCAGCCACAGTGGGGCTGG - Exonic
1133301117 16:4783589-4783611 GGCAGAGGGCAGAGTGGGCAGGG - Intronic
1133935767 16:10267970-10267992 GGCAGAGGTTACAGTGGGCAAGG + Intergenic
1133969808 16:10559377-10559399 AGCTCCAGCCACAGTGAGCATGG - Intronic
1134232441 16:12439191-12439213 GGAAGCAGCCTCTGTAGGCAGGG + Intronic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1136031129 16:27503931-27503953 CGGAGCTCCCACAGTGGGCAGGG - Intronic
1136053690 16:27672182-27672204 GGCAGCAGTCACGGGGGACAGGG - Intronic
1136397952 16:30003279-30003301 GGCTGAAGCCATAGTGGGAAGGG + Intronic
1137564299 16:49523783-49523805 GGCAGCTGCCACAGGAGGCTGGG - Intronic
1137716844 16:50603370-50603392 GGCTGCAGCCTCAGTGTGCTGGG + Intronic
1137852183 16:51756651-51756673 GGAAGCCCCCACAGCGGGCAAGG - Intergenic
1138461588 16:57151550-57151572 AGCAGCAGAAACAGTGGGGAAGG + Intergenic
1138481346 16:57305406-57305428 GGCAGAAGCCACAGGGTGCCAGG + Intergenic
1138539155 16:57678071-57678093 GGAAGCAGGCACACTGGGTAGGG - Intronic
1138930642 16:61651740-61651762 GGAAGCAGACGCATTGGGCAGGG - Exonic
1139366866 16:66438942-66438964 GGCATTACCCACAGTGAGCAGGG - Intronic
1140701013 16:77581575-77581597 GGCTGCAGCCACAATAGGGAGGG - Intergenic
1140731182 16:77858144-77858166 GGCAGAAGCCACAGAGGCCGTGG + Intronic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141647032 16:85373140-85373162 AGCAGCAGCCAATGTGGCCATGG + Intergenic
1141783512 16:86181703-86181725 GTCAGCAACCACAGGGGGCGGGG + Intergenic
1141809526 16:86365700-86365722 GGCAGCAGCTGCTGTGGGGAGGG + Intergenic
1142379652 16:89724064-89724086 GGCAGCAGCCGCAGAGGCAACGG - Intronic
1142427159 16:90007284-90007306 GGCAGGAGTCACAGTGGGGCTGG + Intronic
1142696904 17:1638837-1638859 AGCAGCAGGCACAGCAGGCAAGG + Exonic
1142741532 17:1934542-1934564 GGGAGGAGCCGCAGGGGGCAGGG - Intergenic
1143027145 17:3947621-3947643 GCCAGGAGCCACCGTGGGCCGGG + Exonic
1143259344 17:5586402-5586424 ACCAGCAGCCCCAGTGGGCGTGG - Intronic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1143659955 17:8318692-8318714 GGCAGCAGCAACATGGGGCAGGG - Intronic
1144250100 17:13407748-13407770 GCCAGCAGCCACAGAGGGTGAGG - Intergenic
1144407319 17:14964614-14964636 GACAGCACCCACAGTGATCAAGG - Intergenic
1145011550 17:19371108-19371130 GTCAGCACACACAGTGGCCAGGG - Intronic
1146519933 17:33518443-33518465 GGCAGCAGGTGCAGTGGGCTGGG + Intronic
1147035096 17:37673911-37673933 GGCAGAAGCAGCAGTGAGCATGG + Intergenic
1147350212 17:39836273-39836295 GGCAGCAGCAGCAGTGTCCAGGG - Intronic
1147392435 17:40118552-40118574 CTCAGCAGCCACAGTGGTCCTGG - Intergenic
1147759567 17:42788579-42788601 GACAGCAGCCACAATGGACTTGG - Intronic
1148102215 17:45099232-45099254 GGCAGCACTCACTGTGGGGAGGG + Intronic
1148148048 17:45378489-45378511 GCCAGCAGCCAGACTGGGAAAGG - Intergenic
1148798115 17:50207132-50207154 GGCAGCAGCCATAGGGGGCGTGG + Intergenic
1149294415 17:55249060-55249082 GGCAGCAGCCGCTGGGGGCTGGG - Intergenic
1149374986 17:56034804-56034826 GCCAACAGCCCCAGTGAGCAAGG - Intergenic
1149420005 17:56501224-56501246 GCCAGAAGCCAGAGTAGGCAGGG + Intronic
1149565460 17:57637816-57637838 GGCAGCAGCTACAGTGAGGGAGG + Intronic
1150226773 17:63528703-63528725 GGCAGGATCCTCAGGGGGCAGGG - Intronic
1151329213 17:73396907-73396929 GGCACCAGCCACTCTGGGAAGGG + Intronic
1151780136 17:76240237-76240259 GGCTGCAGCCGCAGCGGCCATGG - Exonic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152130154 17:78471739-78471761 CCCAGCGGTCACAGTGGGCAGGG - Intronic
1152301175 17:79495859-79495881 GGCAGAGGCCCCTGTGGGCAGGG + Intronic
1152381527 17:79944831-79944853 GGCAGCAGGCAGGGTGGCCACGG + Intronic
1152481877 17:80559707-80559729 GGTAGCAGGCAAAGTGGGAAGGG - Intronic
1152583554 17:81179425-81179447 GGCACGAGCCTCTGTGGGCACGG + Intergenic
1152603277 17:81276203-81276225 GGCACCTGTCACAGTGGGCAGGG + Intronic
1154978402 18:21481260-21481282 GGCAGCAGACAGTGTGGGCAGGG + Intronic
1155184270 18:23373462-23373484 GGCAGCCACCACAGTGCCCAGGG + Intronic
1155902690 18:31410914-31410936 CGCAGCAGCCACGGCGGGAACGG + Intronic
1156229085 18:35136646-35136668 ACCAGCAGCCACAGCTGGCAAGG + Intronic
1157506232 18:48228605-48228627 GGCGGCAACCACAGTGGGCAAGG - Intronic
1158903317 18:61986658-61986680 GGCAGGAGCCACACTGTGCCTGG - Intergenic
1159954807 18:74511733-74511755 GGCAGCACCAAGAGTGGGAAGGG + Intronic
1160424923 18:78773127-78773149 TGCAGCATCCACAGTGGGAGCGG + Intergenic
1160521016 18:79507976-79507998 GGCAGCAGCTACTGTGGAAAAGG - Intronic
1160782652 19:884664-884686 GGCAGCCGCCGCAGCGGGCGTGG + Intronic
1161318084 19:3627647-3627669 GGTAGCAGCCACCATGGGCTAGG - Intergenic
1161675719 19:5647428-5647450 GGCACCAGCCTGAGTGGACAGGG + Intronic
1161904207 19:7143018-7143040 GAAAGCTGCCACCGTGGGCACGG + Exonic
1162019200 19:7861013-7861035 GGAGGCAGCCACAATGGGCCTGG - Intronic
1162333274 19:10043727-10043749 TGCAGAAGCCACAGTGGGGCTGG + Intergenic
1162725781 19:12689128-12689150 GGCAGCACCAACATTGGGGATGG + Exonic
1162752672 19:12838458-12838480 TGCAGCCGCCGCAGCGGGCAGGG - Intronic
1162968651 19:14167480-14167502 GGCAGCAGGCAGGGTGGGAAGGG - Intronic
1163634276 19:18431175-18431197 TGCAGTAGCCACAGTGGTCCTGG + Intronic
1165061891 19:33208922-33208944 GGCAGCAGGGAGGGTGGGCAGGG + Exonic
1165069884 19:33249069-33249091 GCCAGCAGCCACGGGGGGCCTGG + Intergenic
1165166997 19:33863733-33863755 GCCAGTGGACACAGTGGGCATGG + Intergenic
1165448093 19:35867909-35867931 TGCTGCATCCACAGTGGGCATGG + Intronic
1165468811 19:35991099-35991121 GGAAGCAGCCACAGTGGTCCTGG - Intergenic
1165868578 19:38954222-38954244 GGAGGAAGCCAAAGTGGGCAAGG + Intronic
1166338375 19:42122466-42122488 GGCAGGGGTCACCGTGGGCAGGG - Intronic
1166357313 19:42234765-42234787 GGCAGCAGGGAGAGTGGGCCTGG - Intronic
1166704934 19:44903375-44903397 GGCAGCATGCCCAGTGGGCCTGG + Exonic
1166750411 19:45161786-45161808 GCCAGCAGCCACAGGGAGCCGGG - Intronic
1167119391 19:47507618-47507640 GTCAGCACCCTCAGTGGGGAAGG + Intronic
1167357787 19:49014758-49014780 AGCAGGAGCCACGGTGGGAAAGG + Intronic
1167641785 19:50686542-50686564 GGCAGCACCCAGGGTGGGAAGGG + Intronic
1168110242 19:54188305-54188327 GGGAGCAGCCGCTGTGGGCCTGG - Exonic
1168301507 19:55407577-55407599 GGCCGCAGCCATGGTGAGCACGG - Exonic
925099531 2:1233521-1233543 GGCAGGAGCCGCAGGGTGCAGGG + Intronic
925406067 2:3606183-3606205 GGCACCCACCACATTGGGCAGGG - Intronic
926063488 2:9819707-9819729 GGGAGCCGCCACACTCGGCAAGG + Intergenic
926197789 2:10774151-10774173 GGCGGCAGCCCCTATGGGCATGG + Intronic
927661889 2:25000506-25000528 TGCAGAGGCCACAGTGGGGAGGG + Intergenic
928438681 2:31273306-31273328 GGCAGTGGCCACAGTAGGCTAGG - Intergenic
930094987 2:47560170-47560192 GGAAACAGCTGCAGTGGGCATGG - Intronic
930180698 2:48353190-48353212 GGCAGAAGCCAAACTGGGGAGGG - Intronic
932406916 2:71519475-71519497 GGCAGCAGGGGCAGGGGGCAGGG - Intronic
932735379 2:74250703-74250725 GGCACCACCCACATTGGGAAGGG + Intronic
933430009 2:82164103-82164125 GGGAGCAGCCACATTTGTCAAGG - Intergenic
933791003 2:85883594-85883616 GGGAGCAGGGACAGTGGGGACGG + Intronic
934555644 2:95285740-95285762 AGCAGGAGCCACAGGGGGCTTGG + Intronic
934655581 2:96115421-96115443 GGCAGAAGCCACAGAGGCCAGGG + Exonic
934778594 2:96954544-96954566 GGCAGCAGTCCCAGAGGGCAAGG + Intronic
934894279 2:98100445-98100467 GGCACTAGCCTCAGTGGCCATGG - Intronic
934968337 2:98742807-98742829 GACAGCACGAACAGTGGGCAGGG + Intergenic
937079737 2:119132181-119132203 GGCACCTGTCTCAGTGGGCATGG - Intergenic
938176994 2:129142823-129142845 GGCAGCAGACACGGTGGGAGTGG - Intergenic
938187107 2:129241174-129241196 GGCAGCAGGCACAGGCGGCCAGG - Intergenic
938365565 2:130730485-130730507 GGATGCATCCACAGTGGCCAGGG - Intergenic
938743953 2:134259602-134259624 GGCAGCAGGCAAAGTGGGATGGG - Intronic
938952254 2:136266209-136266231 GTCAGGAGGCACAGTGGTCAGGG + Intergenic
939194405 2:138954616-138954638 GGCTGCAGCCACAGTTTACAGGG - Intergenic
939355153 2:141091911-141091933 GGCAGCAGTCATAGTGGTGATGG - Intronic
939725239 2:145711813-145711835 GGCACCAGCTACAGGGGCCAGGG + Intergenic
941055847 2:160786999-160787021 GGCAGTAGCTAGAGTGAGCAAGG - Intergenic
941478105 2:165972455-165972477 GTCAGGAGCCACAGGGGTCAGGG - Intergenic
942346317 2:175005740-175005762 GGCTCCAGCCACAGTGAGCCTGG - Intergenic
943202677 2:184849163-184849185 CTCACCAGCCACAGTGGTCAAGG + Intronic
944250470 2:197576075-197576097 GGCAGAAGCTACAGTGTGCTGGG - Intronic
944264116 2:197705708-197705730 GGCAGCAGCTACCGCGGGCCTGG + Exonic
946066810 2:216994876-216994898 GGCAGCAGCCACAGTCGCCGGGG + Intergenic
946338987 2:219056549-219056571 TGCAGTAGACACAGTTGGCAGGG + Intronic
947118457 2:226795637-226795659 GGCAGCAGCCATGGTGGCCCTGG + Exonic
947742873 2:232492859-232492881 CTCAGAAGCCACAGTGGCCATGG - Intergenic
948201978 2:236136036-236136058 GGAAGAAGCCACAGAGAGCAGGG - Intergenic
948239664 2:236419469-236419491 GGCAGCAGCCTCAGTGTAGATGG + Intronic
948502444 2:238405358-238405380 GCCAGCTGCCAGAGGGGGCAGGG - Intergenic
948517427 2:238512423-238512445 GCCAGCAGCCACAGTGGGATGGG - Intergenic
948667578 2:239546038-239546060 GACAGAAGCCACAGGGAGCAGGG - Intergenic
948708328 2:239809606-239809628 GGCAGCAGCGAGAGATGGCAGGG - Intergenic
948741303 2:240048333-240048355 AGAAGCAGCCAGAGTGGGGACGG - Intergenic
948852338 2:240714553-240714575 AGCAGCAGCCACCCTGGGCCTGG + Exonic
1169050114 20:2568937-2568959 GGCAGCAGGAACAGTGGGGTAGG + Intronic
1169214464 20:3785371-3785393 GGCGGCAGCCACAAAGTGCAGGG + Exonic
1169290326 20:4344228-4344250 AGCAGCAGCAGCAGTGGGCATGG + Intergenic
1170516469 20:17135395-17135417 GGCAGCAAGCACAGAGAGCAGGG + Intergenic
1170745513 20:19095317-19095339 GGCATCAGCCACAGTTGTCTTGG - Intergenic
1171387271 20:24778850-24778872 GGCGGCAGCCACTGTGGTCAGGG - Intergenic
1172813879 20:37671082-37671104 GTGAACACCCACAGTGGGCAAGG - Intergenic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173059552 20:39648331-39648353 GGCAGCAGGATCAGGGGGCATGG + Intergenic
1173224824 20:41156304-41156326 GGCAGCATTCACTGTGGGCTTGG + Intronic
1173251696 20:41366978-41367000 GGGAGCAGCCCCAGGTGGCAGGG + Intergenic
1173400552 20:42722285-42722307 GGCAGTGGAGACAGTGGGCATGG - Intronic
1173431322 20:42989444-42989466 GGCACCAGCCACATGGGCCAAGG - Intronic
1174776294 20:53345892-53345914 GGCAGCAGCCCCTGGGGCCATGG + Intronic
1174866131 20:54137393-54137415 GGCAGAAAGCACAGTTGGCAGGG - Intergenic
1175776788 20:61658782-61658804 AGCAACACCCACAGTGGACATGG + Intronic
1176125876 20:63474396-63474418 GGCACCAGCCAGCGTGTGCAGGG - Intergenic
1176128136 20:63485110-63485132 GGCAGCACCCACAGGGTGCCAGG - Intergenic
1177781063 21:25622733-25622755 GGCAACAGCCTCGGTGGGGATGG + Intergenic
1178161433 21:29920807-29920829 GGCACCATACACACTGGGCAAGG + Intronic
1178417170 21:32413081-32413103 GGCAGCCGCACCAGTGGACACGG + Intronic
1178823776 21:35998406-35998428 GGCAGCAGTGAAAGTGGGGATGG - Intronic
1178895060 21:36551074-36551096 GGCAGCCACCAGAGTGGGGAGGG + Intronic
1179005545 21:37510959-37510981 AGCATCAGCCAGAGTGGTCAGGG + Intronic
1179241614 21:39597865-39597887 GCCAGCAGCCCCAGTGAGCCTGG + Exonic
1179939044 21:44626613-44626635 GGCAGGAGGCACAGAGGCCATGG + Intronic
1180001591 21:44997734-44997756 TGCAGCCTCCACAGTGGCCAGGG + Intergenic
1180087066 21:45512443-45512465 GGAAGCCCCCACCGTGGGCAGGG + Exonic
1180556722 22:16584282-16584304 GGGAGCAGCCACAGTAGGAAAGG + Intergenic
1180581800 22:16845364-16845386 GGAAGCTGCCCCAGTGGACAGGG + Intergenic
1180874610 22:19169379-19169401 GGCAGCCGGAACAGTGGGGAGGG + Intergenic
1180881096 22:19204006-19204028 GACAGCAGATAAAGTGGGCAAGG - Intronic
1181044943 22:20210028-20210050 GTCTGCAGCCACGGTTGGCAGGG + Intergenic
1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG + Intronic
1181369595 22:22405456-22405478 GGAGGCAGCCACAGAAGGCAAGG + Intergenic
1182015812 22:27038784-27038806 GCCTGCAGACACAGTGGGGAAGG + Intergenic
1182504325 22:30771193-30771215 GGGGGCAGCCTCAGTGGACATGG - Intronic
1183075223 22:35422581-35422603 TGCTGCAGGCACAGAGGGCAGGG + Intronic
1183382812 22:37498879-37498901 CCCAGCACCCACAGAGGGCAAGG - Intronic
1183922236 22:41178283-41178305 AGCAGCAGCAACAGGGAGCAGGG + Exonic
1184186898 22:42871099-42871121 GCCAACAGGCACAGTGGGCGGGG + Exonic
1184423365 22:44394892-44394914 GGCAGCAGCCTGAGTGGGGAAGG + Intergenic
1184750628 22:46484327-46484349 GGCAGCTGCCACCATGGGCTGGG - Intronic
1184927231 22:47651416-47651438 GGCAGGAGCCAGAGTGAGCTGGG + Intergenic
1185015649 22:48341112-48341134 AGCAGCAGCCACAGTGGCTGGGG - Intergenic
1185266601 22:49907242-49907264 GGTAGCAGCGGCAGAGGGCAGGG - Intronic
1203292790 22_KI270736v1_random:11510-11532 GGCAGGAGAGACAGTGTGCAGGG + Intergenic
950185008 3:10939500-10939522 AGAAGCAGCCACAGGGGGCCTGG + Exonic
950369696 3:12518791-12518813 GGCAGCTGCCCCACTGGACAGGG + Intronic
950447999 3:13049120-13049142 GCCAGAACCCACACTGGGCATGG + Intronic
950487363 3:13281590-13281612 GGCTGCAGCGACTGTGGCCATGG - Intergenic
950494638 3:13326285-13326307 GGAAGGAGCTACAGAGGGCAGGG - Intronic
950496697 3:13338141-13338163 GGCAGCAGCCTCAGGGGACTGGG - Intronic
950534458 3:13571110-13571132 GGCAGCAGCCGCTGTGGGCCTGG - Exonic
950613729 3:14142279-14142301 ACCAGCAGACACACTGGGCATGG + Exonic
951333363 3:21391947-21391969 GGCACCAGCAACAGCTGGCATGG + Intergenic
951483651 3:23188269-23188291 GGCATCAGACACAGTAGTCAAGG + Intergenic
952500112 3:33953806-33953828 TGCTGCAGGCACAGTGGGAAGGG - Intergenic
952667235 3:35921969-35921991 GGCAGAGGCCACAATGGGCAGGG + Intergenic
952908819 3:38165284-38165306 GGCAGTAGCCACACTAAGCATGG - Intronic
953823505 3:46230458-46230480 GGCAGCAGGCAGAGTGGTTAGGG + Intronic
954154540 3:48678181-48678203 GGAAGCAGCCTCAGTGGTCCAGG - Intronic
954415031 3:50389136-50389158 GGCTGCAGCCCCGGTGGGCCTGG + Intronic
954437355 3:50503281-50503303 AGCAGCAGCCACAGCGGGCGCGG + Exonic
954952682 3:54489119-54489141 GGCAGAGGCCAGAGTGAGCAGGG + Intronic
955135149 3:56209693-56209715 GTCAGCAGCCAAGGTGGGCCTGG - Intronic
955195486 3:56801786-56801808 GGCAGCCGCCATGGTGGCCAAGG - Intronic
955215675 3:56983359-56983381 GGCAGGGGTCACAGTGGGGAGGG - Intronic
955408912 3:58643253-58643275 GGCAGCAGCTACTGTGGGCCAGG - Intronic
955497172 3:59545760-59545782 GGAAGCAGCAACAGTGGTCTTGG + Intergenic
957048849 3:75396383-75396405 TGCAGCCGCCACATTGAGCAGGG - Intergenic
957447859 3:80338461-80338483 GGCAGGAGCAGCAGTGGGCTGGG + Intergenic
957589650 3:82179494-82179516 GCCACGAGGCACAGTGGGCATGG + Intergenic
959279339 3:104317559-104317581 GGCAGTAGCCATACTGGGCTTGG + Intergenic
959694470 3:109234514-109234536 GGCAGCTGCAGCAGTGGTCATGG - Intergenic
959868491 3:111299851-111299873 GGCAGTACCCACTGTGGGCCTGG - Intronic
961517343 3:127446137-127446159 GGAAGAAGTCACAGTGGCCAGGG + Intergenic
962455577 3:135562621-135562643 AGCAGCAGCAGCAGTGAGCACGG - Intergenic
962598978 3:136976271-136976293 GGCAGCAGTCATGGTGGGTAGGG + Intronic
965236997 3:166137001-166137023 GGCAGCAGCCACATGGGAGAGGG - Intergenic
966931686 3:184679416-184679438 GGGAGCAGCCTCTGTGGGCTGGG - Intronic
967977084 3:195041393-195041415 GGCATCTGCCCCAGGGGGCATGG + Intergenic
968008451 3:195258202-195258224 GGCAACAGCCACAGAGGGTGAGG + Intronic
968441804 4:628032-628054 GGCACCAGCTACACTGGGCAGGG - Intronic
968566477 4:1316216-1316238 AGCTGTAGCCACAGAGGGCAAGG - Intronic
968584827 4:1411444-1411466 GGCAGAGGCCAGAGAGGGCAGGG - Intergenic
968646061 4:1741183-1741205 GGCAGGAGGCAGAGTGAGCAGGG + Intronic
968689794 4:1984565-1984587 GGCAGCGGCCCCAGGGGACACGG - Intronic
968698514 4:2043890-2043912 GCCAGCAGGCACACAGGGCACGG - Exonic
968902714 4:3438970-3438992 GGCAGCAGACACAGGGCTCAGGG + Intronic
969102835 4:4782496-4782518 GGAAGCAATCTCAGTGGGCAGGG + Intergenic
970506979 4:16741724-16741746 GGCAGCAGTGAAAGTTGGCATGG - Intronic
970779709 4:19721762-19721784 AGCAGCAGCCACAGTGGGAGAGG - Intergenic
971673543 4:29595159-29595181 GTCAGGAGGCACAGTGGTCAGGG + Intergenic
974698066 4:65399478-65399500 GGCAGAAGCCTCTGTGGCCAGGG - Intronic
975404665 4:73976181-73976203 GGCAGTGGCTACAGTGGGCTGGG + Intergenic
975620471 4:76291324-76291346 GGCAGAACCCACACTGGGCATGG - Intronic
976140999 4:81991495-81991517 GGCAGCAGCAGCAGTGGGGGTGG + Intronic
976977269 4:91180518-91180540 GGCAGCAGCCAGGCTGGGGAAGG - Intronic
977418392 4:96764317-96764339 GGCTGCAGCGGCAGTTGGCAGGG + Intergenic
978002550 4:103573949-103573971 AGCAGCAGACACAGTGGTGAAGG + Intergenic
978417594 4:108493177-108493199 TGCACCAGCCTCAGTGGCCACGG + Intergenic
978603482 4:110452806-110452828 GCTAGCAGCCACAGTATGCATGG - Intronic
979155984 4:117391774-117391796 GACATCAGCCACGGTGGCCAAGG + Intergenic
979359412 4:119744134-119744156 GGCAGTAGGCACAGACGGCAGGG + Intergenic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
979831055 4:125303872-125303894 GGCAGAAGTCACAGTGCCCATGG - Intergenic
981581002 4:146248175-146248197 GCAAGCAGCAACAGTGGGCCTGG + Intergenic
982258645 4:153473929-153473951 GAGAGCACCCAAAGTGGGCAGGG - Intronic
982547239 4:156749266-156749288 GACAGGATGCACAGTGGGCATGG + Intergenic
982668246 4:158291892-158291914 GGCAGCAGCCTCAGCAGGCTGGG - Intergenic
983298968 4:165901704-165901726 GTAAGCAGGCACAGTGGTCAGGG + Intronic
984743966 4:183195724-183195746 GGAGGCAACCACAGTTGGCAAGG - Intronic
984830888 4:183971884-183971906 TGCAGCAGGCACCGTGGGGAAGG + Intronic
985053703 4:186017892-186017914 GGCAGGAGGCAGAGTGAGCAGGG + Intergenic
985125400 4:186688810-186688832 GGCAGCAGCCACAATGTGGCAGG + Intronic
985639837 5:1058453-1058475 GGCTCCAGCCACAGTGGGAGAGG - Intronic
985660005 5:1152270-1152292 GGAAGATGCCACAGTGTGCAGGG + Intergenic
986497966 5:8365574-8365596 GTCACAAGCAACAGTGGGCATGG + Intergenic
986527912 5:8700666-8700688 GGCAGCAGGTACCTTGGGCAAGG - Intergenic
988581758 5:32474602-32474624 GGCACCAGCCACAGCAGGGAGGG + Intergenic
989497921 5:42131258-42131280 AGCAGCAGCCACAGTATGCAGGG - Intergenic
990431155 5:55736984-55737006 GGCACTAGCCAAAGTGGCCAAGG - Intronic
991134796 5:63168762-63168784 GGCATCAGGCATAGTGGACATGG + Intergenic
992027107 5:72681315-72681337 GGCAGCAGCCATGGTAGGCAAGG + Intergenic
993204320 5:84860989-84861011 AGCTGCAGTCACAGAGGGCAGGG - Intergenic
993335003 5:86646119-86646141 AGCAGCAGCAACAGTGGGGAGGG - Intergenic
993511065 5:88771969-88771991 AGCAGCAGCCACAGATGGCTTGG - Intronic
994843229 5:104952097-104952119 GGCAGCAGCCACAGTGATGATGG + Intergenic
995096253 5:108239356-108239378 GGCAGCAGCCACAAGGCACAGGG + Intronic
996967591 5:129323112-129323134 GGTAGCAGCAGCAGTGGGCAGGG + Intergenic
997460858 5:134051308-134051330 GGCAGCACCCACAGTGGGCTAGG + Intergenic
997864708 5:137450851-137450873 TGGAGCAGCCACAGTGAGAATGG - Intronic
998266181 5:140669408-140669430 GGAAGCGGCCACAGTGGGAGAGG - Exonic
999194863 5:149774985-149775007 AGCTGCAGCCACAGCAGGCAGGG + Intronic
999229419 5:150052851-150052873 GGCTGCAGCAGCAGTGGCCAGGG - Intronic
999393137 5:151208825-151208847 AGCAGAAGCCAGAGTGGGAAGGG - Intronic
999663368 5:153888634-153888656 GACAACAGACTCAGTGGGCAAGG + Intergenic
999698476 5:154206890-154206912 CGCAGGAGCCACAGGAGGCAGGG + Intronic
1000471876 5:161653022-161653044 GGCAGCAGCTAAAATGGGCAGGG + Intronic
1001248997 5:170131446-170131468 GGAAGCAGGCAGAGTGGCCACGG - Intergenic
1001493906 5:172174653-172174675 GGCAGCTGCCACCATGGTCAGGG + Intronic
1002103477 5:176868719-176868741 GGCAGGGGCCACTCTGGGCAGGG + Intronic
1002534947 5:179870879-179870901 CGCAGCAGCCACCTTGAGCACGG + Intronic
1002576615 5:180177523-180177545 GGCAGAAGCCGCAGAGGCCATGG - Intronic
1002837978 6:881382-881404 GGCAGCAGCCACAGTGCAGCAGG + Intergenic
1003501874 6:6709952-6709974 TCCAGGAGCCACAGTGGGAATGG + Intergenic
1003617979 6:7672695-7672717 GACAGCAGCCACGGCGGGCCAGG + Intergenic
1003655506 6:8003413-8003435 GGCTGCAGCCGCAGAGGGAATGG + Intronic
1005317792 6:24620980-24621002 GGTATCAGCCAGGGTGGGCATGG + Intronic
1005840549 6:29742313-29742335 GGCGGAACCCACAGTGGGCAGGG - Intergenic
1005849831 6:29813155-29813177 GGCAGAACCCACAGCGTGCAGGG - Intergenic
1006060410 6:31414583-31414605 GGCAGAGCCCACAGTGGGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006633544 6:35446303-35446325 GGCAGCCCAGACAGTGGGCATGG - Intergenic
1007117175 6:39350983-39351005 GGCAGCAACCACAGGGGACAGGG + Intronic
1007382985 6:41502701-41502723 GGCACCAGCCCCACTGGGCCAGG + Intergenic
1007410133 6:41656723-41656745 GACTGCAGCCACAGTGTCCAGGG + Intergenic
1007733936 6:43968689-43968711 GGAGGCAGCCAAGGTGGGCAGGG + Intergenic
1010127013 6:72444308-72444330 TCCTGAAGCCACAGTGGGCAGGG + Intergenic
1010456608 6:76063743-76063765 TGCAGCAGCCACATAGGGCTGGG + Intronic
1010792074 6:80075981-80076003 GCCACTGGCCACAGTGGGCAGGG + Intergenic
1011333306 6:86234049-86234071 GACACCAGCCAAAGTGGGTAAGG - Intergenic
1012315078 6:97775315-97775337 GGAAGGAGCCTCAGTGGGGAGGG + Intergenic
1012839092 6:104306772-104306794 GGCAGTAGCAACAGAGGGAAAGG + Intergenic
1013387413 6:109645486-109645508 GGCAGCAGCCAGGCTGGGCGAGG + Intronic
1014005061 6:116408555-116408577 AGGAGCAGCCACAGTACGCAGGG - Intronic
1014737837 6:125115036-125115058 GGCAGTGGCCCCACTGGGCAAGG + Intergenic
1014746028 6:125202057-125202079 GGCTGCAGTCCCAGTAGGCATGG + Intronic
1014923956 6:127248217-127248239 CTCAGCAGCCACCGTGGTCAGGG - Intergenic
1015813608 6:137185681-137185703 GGCAGCAGCCAGACTGGTGAGGG - Intergenic
1016418330 6:143856894-143856916 GGCAGGAGGCACAGGGGTCAGGG + Intronic
1016805256 6:148205885-148205907 AGCTGCACCCACAGTGGGTAGGG - Intergenic
1016832104 6:148444422-148444444 GTCAGCAGCCCCACTTGGCAGGG - Intronic
1016915142 6:149237743-149237765 GCCAGCACCCACAGTGGGAGGGG - Intronic
1017124355 6:151051777-151051799 GGCAGAGACCACAGTGGGCAGGG + Intronic
1018855067 6:167669220-167669242 GGCAGGGGCCACAGAGAGCAGGG + Intergenic
1019097732 6:169598712-169598734 TGTAGCAGCCACAGAGGCCAGGG + Intronic
1019171100 6:170133591-170133613 GGCAGGTGCCTCAGTGGGTAGGG + Intergenic
1019450641 7:1095944-1095966 GGCAGCAGCGGCAGCGGGGAGGG + Intronic
1019526612 7:1483262-1483284 GGCTGCGGCCGCAGAGGGCACGG + Intronic
1020771741 7:12403924-12403946 GCCAGCAGCCAAAATGGGAAGGG - Intronic
1021123780 7:16826626-16826648 GGCAGTACTCACAGTGGGCATGG + Intronic
1022480630 7:30741009-30741031 GGCAGCAGCCAGGGTGTGCAGGG + Intronic
1022544462 7:31173262-31173284 GCCAGGACCCACAGAGGGCAGGG + Intergenic
1022798837 7:33755725-33755747 GGGATCAGCCACAGAGAGCATGG + Intergenic
1023611619 7:41977535-41977557 GTAAGCATCCTCAGTGGGCATGG - Intronic
1024059981 7:45690362-45690384 TGGGGCAGCCACAGTGGGAATGG + Intronic
1024094449 7:45972952-45972974 GGCACAAGCCCCTGTGGGCAGGG + Intergenic
1024469294 7:49750462-49750484 GGCAGAGGTCACAGTGGGCTGGG + Intergenic
1024982053 7:55165719-55165741 GGCAGCTGCCACAGTCTCCAGGG + Intronic
1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG + Intergenic
1025665409 7:63580620-63580642 GGCAGGAGCCACAGTGGGAAGGG - Intergenic
1028413186 7:90552954-90552976 GGCAGCAGCAAAATTGGCCAGGG + Intronic
1028798228 7:94929770-94929792 TGCAGCAGTCACAGTGAACACGG + Intronic
1029492542 7:100880067-100880089 TGCAGGAGCCACACTGGCCAAGG + Intronic
1029545631 7:101209017-101209039 GGCAGCAGGCAGAATGGGAAGGG + Intronic
1029709433 7:102291597-102291619 GGCAGAAGGCAAAGTAGGCATGG - Intronic
1029954888 7:104627747-104627769 CACAGCAGCTACAGTGTGCAAGG - Intronic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1030808409 7:113945358-113945380 AGCAGCAGCTCCAGTGGGGATGG - Intronic
1032012648 7:128356945-128356967 GACACCAGCCAGAGTGGTCAGGG + Intronic
1032388360 7:131539759-131539781 TGCAGCACCCAGACTGGGCACGG - Intronic
1032942490 7:136810826-136810848 GGCAGTACTCACAGTGGGCCTGG + Intergenic
1033291054 7:140082990-140083012 GGGAGCAGCCCGGGTGGGCAAGG + Intergenic
1034213559 7:149385721-149385743 GGCAGCAGGCCCAGAGTGCATGG - Intergenic
1034359280 7:150479955-150479977 GGAAGAAGCCAAATTGGGCAGGG + Intergenic
1034617365 7:152430107-152430129 GGCGGCAGCCACAGTGAGCCAGG + Intronic
1034620589 7:152453748-152453770 GGGAGCAGCCACAGTAGGGAGGG - Intergenic
1034921025 7:155082208-155082230 GCCAGCATCCACAGTGTGAATGG + Intronic
1035627002 8:1077975-1077997 GGCAACAGCCACAGAGGACATGG - Intergenic
1036439307 8:8766141-8766163 GGCAGCAGGGACTGTGGGCAAGG + Intergenic
1036767526 8:11558215-11558237 GGCAGGAGGCACAGTGGCCAGGG - Intronic
1038429257 8:27486550-27486572 GGCAGCAGCAGCAGCGGCCAGGG - Intergenic
1039466484 8:37788658-37788680 GGCAGTAGCCACATATGGCATGG + Intronic
1039664892 8:39514572-39514594 GGCAATAGCCAAAGTGGGTAAGG - Intergenic
1039910955 8:41826459-41826481 GGCAGCAGAGACAGAGGGCAGGG - Intronic
1040564391 8:48552964-48552986 AGCACCAGGCAGAGTGGGCAAGG + Intergenic
1040802695 8:51361062-51361084 AGCAGTGGCCACAGTGGGCCTGG - Intronic
1041433967 8:57817488-57817510 GGCAGTAGGGGCAGTGGGCAGGG - Intergenic
1041718130 8:60950595-60950617 GGGAGCAGTTCCAGTGGGCAGGG + Intergenic
1042837300 8:73090464-73090486 CCCAGGAGCCACAGTCGGCATGG + Intronic
1043538290 8:81230210-81230232 GGGAGAAGACACAGTGGGGAAGG + Intergenic
1043910182 8:85854977-85854999 GAAAGCAGCCATAGTGGGTATGG - Intergenic
1046832759 8:118764337-118764359 GGCAGTGGACACAGTGGGCCTGG - Intergenic
1047121373 8:121908609-121908631 GTCAGGAGCCACAGGGGTCAGGG - Intergenic
1047698557 8:127427930-127427952 GGCTGCATCTACAGTTGGCATGG - Intergenic
1047952597 8:129947480-129947502 GGCAGGAACTGCAGTGGGCATGG - Intronic
1048009630 8:130445151-130445173 GACGGCAGCTACAGTGGGCCTGG - Intergenic
1048233547 8:132667826-132667848 GGGAGCAGGGACAGAGGGCACGG + Intronic
1048499471 8:134962470-134962492 GGTAACTGCCACAGTGGGAATGG - Intergenic
1049175323 8:141189194-141189216 GGCAGAAGGCACAGCGGGTAGGG + Intronic
1049197967 8:141325801-141325823 GGCTGCAGCCACAGAAGGCGGGG + Intergenic
1049329584 8:142043106-142043128 GGCAGCAGCCAAGGTGGGGCGGG + Intergenic
1049389114 8:142359029-142359051 GGCAGAACCCCCAGTGAGCAAGG - Intronic
1049411136 8:142474508-142474530 GGCAGCAGCACCAGGGGGCCGGG - Intronic
1049418376 8:142505792-142505814 GGCGGCGGCCACAGTAGCCAGGG + Intronic
1049478580 8:142808233-142808255 AGCAGCAGCAGCAGTGGGCTGGG + Intergenic
1049585995 8:143432609-143432631 GGCAGGAGCCACAGTGCGATGGG - Intergenic
1049660518 8:143817788-143817810 GGCAGGAGCAGCAGTGAGCAGGG + Intronic
1049699861 8:144005637-144005659 GGAATCAGCCACTGTGGGGAGGG - Intronic
1050906402 9:11011920-11011942 GGGAGCGGCCACGGTGGGGAGGG + Intergenic
1051156751 9:14156616-14156638 GGCAGGGTCCACAGTGGCCATGG + Intronic
1051197376 9:14577272-14577294 GGCATCAGCTGTAGTGGGCAGGG - Intergenic
1052204034 9:25816406-25816428 GCTAGCAGCCACAGTGTCCAAGG - Intergenic
1052780761 9:32780389-32780411 GTCAGCAGCAACAGTGGGTAGGG - Intergenic
1057172272 9:92969968-92969990 GGCTGAGTCCACAGTGGGCACGG + Intronic
1057230744 9:93319951-93319973 GGCAGCCCCCACAGTGGACCGGG - Intronic
1057604593 9:96489852-96489874 GGCAGGACCCACAGTGGGAAGGG - Intronic
1057910456 9:99016082-99016104 TTCAGGAGCCACTGTGGGCAGGG - Exonic
1058754905 9:108075226-108075248 GGCAGCAGCCAGAGTGGCCCAGG + Intergenic
1058822340 9:108744289-108744311 ATCTGCAGCCACACTGGGCAGGG + Intergenic
1058917951 9:109585848-109585870 GGCTGCAGACACACTGGGGAGGG - Intergenic
1060539469 9:124419892-124419914 GGCAGCAGCCATGCTGGGCAGGG - Intergenic
1060822556 9:126669896-126669918 GACAGGAACCACAGTGGCCATGG + Intronic
1061078832 9:128357835-128357857 GGCAGAAGCCACATTGGCTAGGG - Intronic
1061144828 9:128791511-128791533 AGCAGCAGCCGCAGGAGGCAGGG - Intronic
1061223270 9:129264852-129264874 AGAAGCAGCCACAGTGGGCCAGG + Intergenic
1061650228 9:132041807-132041829 GGCAGCTGCCACCGTAGGCCAGG - Intronic
1061678103 9:132229603-132229625 GGGTGCAGCCACAGTAAGCAAGG - Intronic
1061833294 9:133310429-133310451 GGCAGCAGCGACGCTGGGGAAGG + Intergenic
1061841764 9:133362625-133362647 AGCCGCAGCCGCTGTGGGCAGGG - Exonic
1062032291 9:134367173-134367195 TGCAGCAGCTCCAGCGGGCACGG - Intronic
1062151675 9:135022525-135022547 GGCAGGCGCCACAGTGGCCCAGG + Intergenic
1062388011 9:136322366-136322388 GCCAGCAGCCTCAGTGGGAGTGG + Intergenic
1062559887 9:137136787-137136809 CGCAGCTGTCAGAGTGGGCAAGG + Intergenic
1062707469 9:137953417-137953439 AGGAGCAGCCAGAGTGGGGATGG + Intronic
1186163637 X:6804264-6804286 GGCATCAACCACAGTGGAAACGG - Intergenic
1187960890 X:24565119-24565141 GGCAGCAGGCACAGTAGGCTGGG - Intronic
1191615177 X:63162768-63162790 CTCACCAGCCACGGTGGGCAGGG - Intergenic
1191621121 X:63216155-63216177 CTCACCAGCCACGGTGGGCAGGG + Intergenic
1191879264 X:65828313-65828335 CACAGAAGCCACAGTGGGGAGGG + Intergenic
1192048488 X:67701431-67701453 GGCTGAAGCCAGAGAGGGCAAGG - Intronic
1192237072 X:69302769-69302791 AGCAGGGGCCTCAGTGGGCAAGG + Intergenic
1192261093 X:69506187-69506209 GGCAGCGGCCGCAGTGGGACCGG + Intronic
1192548036 X:72029539-72029561 AGGAGCAGCCACAGTGGGATTGG - Intergenic
1193076702 X:77363144-77363166 GCCAGCCTCCACAGTGGCCACGG - Intergenic
1193443137 X:81567494-81567516 GGCAGCAGTGGCAGTGAGCAGGG - Intergenic
1194872272 X:99146988-99147010 GGCACCAGCCATTGTAGGCATGG - Intergenic
1196603472 X:117628134-117628156 TTCAGCAGCCACGGTGGGAAAGG + Intergenic
1197413961 X:126151290-126151312 GGCACCACCCACAGAGAGCAAGG - Intergenic
1197720110 X:129739219-129739241 GGCAGCAGCCCCAGTGAGCCCGG - Exonic
1197796600 X:130305188-130305210 GGCATCAGCCATGGAGGGCAGGG + Intergenic
1197907558 X:131442723-131442745 AGCAGGAGCCTGAGTGGGCAGGG - Intergenic
1197911809 X:131491268-131491290 AGCAGGAGCCTGAGTGGGCAGGG - Intergenic
1198738740 X:139817486-139817508 GGCAGGAGCCAGACTGTGCAGGG + Intronic
1198758081 X:140001577-140001599 GTCAGGAGGCACAGTGGTCATGG - Intergenic
1199721145 X:150543504-150543526 GCCAGCAGCCACAGGGAGCCTGG - Intergenic
1200088473 X:153623438-153623460 GGGAGCAAACACAGGGGGCAAGG - Intergenic
1200740216 Y:6846294-6846316 GTCAGCAGGCACAGGGGACAGGG + Intergenic