ID: 1130717583

View in Genome Browser
Species Human (GRCh38)
Location 15:86350857-86350879
Sequence CCATTAGGGCATAAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130717583_1130717587 -3 Left 1130717583 15:86350857-86350879 CCTGGTGGCTTATGCCCTAATGG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1130717587 15:86350877-86350899 TGGAAAATGTGTTAATCCGTTGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130717583 Original CRISPR CCATTAGGGCATAAGCCACC AGG (reversed) Intronic
900298704 1:1965795-1965817 CTGTCAGGGCAAAAGCCACCTGG - Intronic
900918924 1:5658648-5658670 CCTTGATGTCATAAGCCACCAGG - Intergenic
902292678 1:15445564-15445586 CCGGGAGGGCATAAGCCACCAGG - Intronic
903926127 1:26831953-26831975 CCACTAGACCATAAGCCACAAGG + Intronic
910177157 1:84443089-84443111 CCCTTGGGGCCTATGCCACCAGG + Intergenic
913100545 1:115560141-115560163 CCATGAGGGGAAAAGCCAGCTGG + Intergenic
921937279 1:220806814-220806836 CCATGAGGGCCTAGGCCACCTGG + Intronic
1065172346 10:23044031-23044053 CCAGTAGAGCATAAGGCATCAGG - Intergenic
1070170684 10:73930666-73930688 ACATACAGGCATAAGCCACCTGG - Intergenic
1072619308 10:97069025-97069047 CCATTAGGGCAGGCACCACCAGG - Intronic
1074079715 10:110157859-110157881 TCATTAGGGCATAAGCCTCATGG - Intergenic
1076897939 10:133323324-133323346 GGATTAGGGCATCAGCCACTGGG + Intronic
1089651262 11:119914935-119914957 CCACTAGGCCATAATCCACTAGG - Intergenic
1093756871 12:22862656-22862678 CCATGAGGGGATAAGCATCCAGG - Intergenic
1095396409 12:41767182-41767204 TCATTAGAACATAAGCTACCTGG + Intergenic
1101312985 12:103600663-103600685 CCATTGGGTCACAAGCCACTAGG + Intronic
1102023483 12:109699794-109699816 CAATTAGGCCAGAAGCCATCAGG - Intergenic
1108133009 13:47323595-47323617 CCATGAGGGCATAACCCTCCAGG + Intergenic
1108475322 13:50810606-50810628 GCATTAGGGGAAAGGCCACCGGG + Intronic
1108575153 13:51784177-51784199 CCTTGAGGGCAGAATCCACCTGG - Intronic
1116392267 14:44407257-44407279 CCCTTAGGGTAATAGCCACCAGG - Intergenic
1119691197 14:76674053-76674075 CCTTTAAGGCAAAAGCCAACAGG - Intergenic
1123970731 15:25505670-25505692 ACATTAGAGCATAAGGCACCGGG + Intergenic
1124843300 15:33264742-33264764 CAATCAGGGCATGAGCCACATGG - Intergenic
1126211272 15:46103713-46103735 CCATTAGGGCATATCCTACAAGG + Intergenic
1128612285 15:69083788-69083810 CCATTAAGGGACAAGCTACCTGG + Intergenic
1128820042 15:70643579-70643601 CAATTAGTGTATAAGCCACATGG + Intergenic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1143210631 17:5184642-5184664 CCACTAGGGTAAATGCCACCAGG + Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1147821510 17:43244422-43244444 CCTTTACGGGATCAGCCACCGGG - Intergenic
1148866345 17:50630743-50630765 CAATGAGGGCATCAGACACCAGG + Intergenic
1149010846 17:51854718-51854740 CTGTTAGGTCATAAGCCACGTGG - Intronic
1149254396 17:54808368-54808390 CCATTAGGGTATAACCCAAAAGG - Intergenic
1149332238 17:55596100-55596122 GGATTAAGGCATATGCCACCAGG + Intergenic
1153000348 18:449746-449768 CCATGAGGGCAGAAGTGACCTGG - Intronic
1156458102 18:37306037-37306059 CCATCAGGGCAGAAGCCCACTGG - Intronic
1158438737 18:57454564-57454586 CCATAAGGGTATATGGCACCTGG + Intronic
1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG + Intronic
925988184 2:9232580-9232602 CCATTAGATCATAAGCTTCCTGG + Intronic
937375848 2:121335169-121335191 CCATGATGGCCTAAGCCGCCTGG - Intergenic
938726905 2:134116942-134116964 ACATTATGGCATCAGCCACTGGG + Intergenic
940276594 2:151946683-151946705 CCAGCAGGGCACAAGGCACCTGG + Intronic
942239401 2:173945852-173945874 GGATTAAGGCATGAGCCACCAGG - Intronic
942348466 2:175028200-175028222 ACTTTAGGGCAAAAGCCAACAGG - Intergenic
946055102 2:216894237-216894259 GGATTCAGGCATAAGCCACCGGG - Intergenic
1171250165 20:23640476-23640498 CCATAAGGGCATTTGCCACAGGG - Intergenic
1171256267 20:23691006-23691028 CCATAAGGGCATTTGCCACAGGG - Intergenic
1171263620 20:23752916-23752938 CCATAAGGGCATTTGCCACAGGG - Intergenic
1171445950 20:25205166-25205188 CCACTAGGCCATGAGCCCCCAGG - Intronic
1176741391 21:10606723-10606745 GTATTAAGGCATGAGCCACCAGG + Intergenic
1177454371 21:21316902-21316924 CCATTAGCACATAAACCCCCCGG + Intronic
949293339 3:2491347-2491369 CCATTAGAGCGTAAGGCATCTGG - Intronic
950871088 3:16229780-16229802 CAATTAGGCAATAAGCCATCTGG - Intronic
956541223 3:70341710-70341732 CCACGAGGACATAAGCCAACAGG + Intergenic
958270124 3:91489359-91489381 CCATTAGTCAATAAGGCACCTGG - Intergenic
966730421 3:183146437-183146459 CCATTAGGGCAGAAGTCACAGGG + Intronic
971758269 4:30730672-30730694 CCAATTGGGCATAAGACACTGGG + Intronic
977944453 4:102895930-102895952 CCATTAGCTCAAAAGCCAACTGG + Intronic
982199236 4:152943769-152943791 GCATGAGGTCATAATCCACCAGG - Intronic
985130004 4:186729451-186729473 CCATTAGAACATTAGACACCTGG + Intergenic
992875552 5:81050927-81050949 CCATTAGGGCAGAAGAAAGCTGG + Intronic
1001365431 5:171133645-171133667 CCATGTGGGCATAGGCTACCCGG + Intronic
1004257222 6:14075961-14075983 CCATTAAGGTATAATCCACTGGG - Intergenic
1005955432 6:30660121-30660143 CCATTGTGGCTGAAGCCACCAGG + Exonic
1008985035 6:57531979-57532001 CCATTAGTCAATAAGGCACCTGG + Intronic
1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG + Intergenic
1027260746 7:76462631-76462653 CCATCCGGGCTTAAGCCATCCGG + Intronic
1027312125 7:76960744-76960766 CCATCCGGGCTTAAGCCATCCGG + Intergenic
1032346077 7:131118106-131118128 CAATTAGGTCATAAGAGACCTGG + Intronic
1033845886 7:145431495-145431517 TCATTAGGGCATAATGCAGCTGG - Intergenic
1039553359 8:38459192-38459214 CATTTAGGACAGAAGCCACCTGG - Intronic
1043527248 8:81111056-81111078 GCCTTAGGGCATAAAACACCGGG + Intronic
1045505661 8:102776761-102776783 CCACTAGGGCAAAAGCCACTAGG + Intergenic
1047360896 8:124168364-124168386 GAATTAGGGAATAAGGCACCTGG - Intergenic
1049706693 8:144046373-144046395 CCAGTAGGGCCTCAGCCACAGGG - Intronic
1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG + Exonic
1060064460 9:120491150-120491172 TCATTTGGGCTTCAGCCACCAGG - Intronic
1060274351 9:122171211-122171233 CCGTCAGGGCAGAAGCCTCCAGG + Intronic
1185543813 X:925873-925895 CCTTTTGTGCATAAGCCAGCTGG + Intergenic
1187236389 X:17471409-17471431 CCATTTTTGCATGAGCCACCGGG + Intronic
1196661744 X:118277935-118277957 CCATAAAGGCATAAGTGACCAGG - Intergenic
1202599711 Y:26580875-26580897 GTATTAAGGCATGAGCCACCAGG + Intergenic