ID: 1130718592

View in Genome Browser
Species Human (GRCh38)
Location 15:86363193-86363215
Sequence GCAGACAAAAGTGCCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130718592_1130718597 10 Left 1130718592 15:86363193-86363215 CCTACAAAGGCACTTTTGTCTGC 0: 1
1: 0
2: 5
3: 38
4: 308
Right 1130718597 15:86363226-86363248 TGCCAGATCAATTTTTGTGTGGG 0: 1
1: 0
2: 9
3: 15
4: 214
1130718592_1130718596 9 Left 1130718592 15:86363193-86363215 CCTACAAAGGCACTTTTGTCTGC 0: 1
1: 0
2: 5
3: 38
4: 308
Right 1130718596 15:86363225-86363247 TTGCCAGATCAATTTTTGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 166
1130718592_1130718600 25 Left 1130718592 15:86363193-86363215 CCTACAAAGGCACTTTTGTCTGC 0: 1
1: 0
2: 5
3: 38
4: 308
Right 1130718600 15:86363241-86363263 TGTGTGGGCAGATGCAAACTGGG 0: 1
1: 0
2: 0
3: 13
4: 173
1130718592_1130718599 24 Left 1130718592 15:86363193-86363215 CCTACAAAGGCACTTTTGTCTGC 0: 1
1: 0
2: 5
3: 38
4: 308
Right 1130718599 15:86363240-86363262 TTGTGTGGGCAGATGCAAACTGG 0: 1
1: 0
2: 1
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130718592 Original CRISPR GCAGACAAAAGTGCCTTTGT AGG (reversed) Intronic
900752399 1:4406933-4406955 GCAGCCATAAGTGCCAGTGTGGG - Intergenic
900848900 1:5126468-5126490 GGGGACTAAACTGCCTTTGTAGG + Intergenic
902637781 1:17746203-17746225 GGAGACTAGATTGCCTTTGTAGG + Intergenic
903442031 1:23395358-23395380 GCAGCCAAAAGTTCCTCTGAGGG - Intronic
904112502 1:28137234-28137256 GAAGACTAGACTGCCTTTGTAGG - Intergenic
907721470 1:56976193-56976215 GCAGGCAAAAGAGCTTATGTGGG - Intergenic
908053182 1:60255248-60255270 CCACACAAAGGTGCTTTTGTAGG + Intergenic
909542388 1:76805379-76805401 GCAGACAAAAGTGTGTGTTTTGG - Intergenic
912057534 1:105623234-105623256 ACAGTCAAAAGTGCCTTTGCAGG - Intergenic
912390903 1:109302188-109302210 GCATACACACGTGCCTATGTGGG + Intronic
913402876 1:118455380-118455402 GGAGGAAAAAGTGGCTTTGTGGG - Intergenic
915271210 1:154755028-154755050 ACAGACAAAAGTGACTTAGAAGG - Intronic
918751726 1:188280585-188280607 GCAGGAAAAAGTGCTTGTGTAGG + Intergenic
919869367 1:201808862-201808884 GCAGACACAGGTACCTGTGTGGG + Exonic
920257169 1:204663465-204663487 GCAGACAGAAGAGCCTGTGATGG - Intronic
921684133 1:218070578-218070600 GCAGGCAAGAGGGCCTGTGTAGG - Intergenic
922275078 1:224070021-224070043 GCAGACAAAAGTGAATGGGTGGG - Intergenic
922427543 1:225513689-225513711 TCAAACAAAAGTGCATGTGTAGG + Intronic
924483711 1:244460203-244460225 GGAGACTAGATTGCCTTTGTAGG + Intronic
1062764627 10:51412-51434 GCAGGCAAAAGAGCTTGTGTAGG - Intergenic
1063811469 10:9713626-9713648 GGAAAGAAAAGTGCCTTTGTGGG - Intergenic
1065088403 10:22203824-22203846 GCAGAGAGAAGTGGCTTTTTTGG + Intergenic
1065189087 10:23194439-23194461 ACAGACAAAAGTTGCTGTGTAGG - Intergenic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1066065275 10:31757202-31757224 GCAGAGAACACTGACTTTGTAGG + Intergenic
1066271040 10:33823780-33823802 GCAAACAAAAATGCCTTGTTTGG + Intergenic
1067193915 10:44097323-44097345 GCAAAGAAAAATGCCTTTGATGG + Intergenic
1067272808 10:44806637-44806659 TCAGAAAAAAGTGCCTTTGGAGG - Intergenic
1068193022 10:53678286-53678308 GTAGACAAAAGTGGCTGTGCTGG + Intergenic
1069059634 10:63882128-63882150 ACAGACAAAAGTACCTTTATGGG - Intergenic
1073806831 10:107107636-107107658 ACAGACAAAATAGCCTTTGTGGG + Intronic
1074931895 10:118135972-118135994 GCAGACAAAAGAGCTTGTGTAGG + Intergenic
1075490506 10:122863894-122863916 GAAGACCAAAGTCCTTTTGTAGG - Intronic
1076099732 10:127766517-127766539 GGAGACTAGACTGCCTTTGTAGG - Intergenic
1078711956 11:13801346-13801368 GCAGACAAGAGTGCTTGTGCAGG + Intergenic
1080795143 11:35556624-35556646 GCAGATAGAAGTGCCTTCTTCGG + Intergenic
1080841298 11:35985730-35985752 GCAGGCAAGAGAGCCTGTGTAGG - Intronic
1081402767 11:42661936-42661958 ACTGACAAACGTGCCTTGGTGGG - Intergenic
1082867498 11:57913178-57913200 GGGGACTAAATTGCCTTTGTAGG - Intergenic
1083198448 11:61104912-61104934 GCACACGGAAGTGCCTTTGGTGG - Intronic
1083466899 11:62853738-62853760 GTAGGAAAAAGTGCCTTTTTAGG - Intergenic
1085014348 11:73163102-73163124 GGACTCAAGAGTGCCTTTGTTGG + Intergenic
1086515190 11:87603881-87603903 ACAGATAAAAGTGCCATTGTGGG + Intergenic
1088377688 11:109159969-109159991 GGAGGAAAAAGTGGCTTTGTGGG - Intergenic
1091494049 12:957064-957086 GCAGACAAAAGTCCTTATCTGGG + Intronic
1092057175 12:5517048-5517070 GAAAGCAAAGGTGCCTTTGTAGG + Intronic
1092636274 12:10454210-10454232 ACAGACAAAAGTTCCTTTGAGGG + Intronic
1093691429 12:22113962-22113984 GGAGACTAGACTGCCTTTGTAGG + Intronic
1094814419 12:34169148-34169170 GCAGGCAAAAGAGCTTGTGTAGG - Intergenic
1095102505 12:38199437-38199459 GCAGGCAAAAGAGCTTGTGTAGG + Intergenic
1095328641 12:40929910-40929932 GCAGGAATAATTGCCTTTGTCGG - Exonic
1095520974 12:43065260-43065282 GGAGACAATAGAGCCTTTTTAGG - Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1096436647 12:51596617-51596639 GAGGGCAAAAGTGCCTTTGAAGG + Intronic
1096589738 12:52649749-52649771 GCAAACAAAATTGTCTCTGTAGG - Intronic
1096734842 12:53644609-53644631 GCACACAAAAGTCCCTTTCTGGG + Intronic
1097358574 12:58631372-58631394 ACAAACAAAAGTCTCTTTGTGGG + Intronic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099525786 12:83718209-83718231 GCAGACAAGAGAGCTTGTGTTGG - Intergenic
1099601076 12:84738575-84738597 GCAGGCAAATGTGCCTCAGTAGG - Intergenic
1099800531 12:87451572-87451594 GGAGAAAAAAGTGGTTTTGTGGG + Intergenic
1100413011 12:94340990-94341012 GCAAACAAAAGGGACTTTCTTGG - Intronic
1101793993 12:107956146-107956168 GCAGACAAGAGTGCCAATTTCGG - Intergenic
1102740723 12:115205265-115205287 GGAGACTAGACTGCCTTTGTAGG + Intergenic
1105692668 13:22858036-22858058 GCAGACGTAAGTGGCTATGTAGG - Intergenic
1106499054 13:30309544-30309566 GCAGGCAAAAGAGCTTGTGTAGG - Intergenic
1107299536 13:38950415-38950437 GCAGACCAGACTGCCTTTGTTGG - Intergenic
1109056998 13:57563388-57563410 GGAGACTAGACTGCCTTTGTGGG - Intergenic
1110034127 13:70657254-70657276 GCAGGCAAAAGAGCTTGTGTAGG - Intergenic
1110148604 13:72223483-72223505 GCAGTCAAAAGAGCTTGTGTAGG + Intergenic
1110196513 13:72794647-72794669 GCAGACAAGAGTGCTTGTGCAGG - Intronic
1111256568 13:85677250-85677272 GAGGACTAAACTGCCTTTGTAGG - Intergenic
1111388320 13:87559732-87559754 GCAGGCAAAAGAGCTTGTGTAGG + Intergenic
1111590171 13:90336503-90336525 ACAGACAAGAGCACCTTTGTGGG + Intergenic
1112281480 13:98066395-98066417 GCAGGTAAAAGAGCATTTGTGGG - Intergenic
1112865257 13:103887913-103887935 GGAAACAAAAATGCCTTTATTGG - Intergenic
1114438512 14:22727767-22727789 GGAGACTAGACTGCCTTTGTAGG - Intergenic
1115816247 14:37167568-37167590 GGAGACTAGACTGCCTTTGTGGG + Intronic
1116119158 14:40699839-40699861 GGAGACTAGACTGCCTTTGTAGG + Intergenic
1116256199 14:42559468-42559490 GGAGAAAAAAGTGGTTTTGTGGG - Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1116761158 14:49016650-49016672 GCAGAAAATAGTGCCTTTGAAGG + Intergenic
1119854492 14:77889066-77889088 GCAGGCAAGAGAGCCTTTGCAGG - Intronic
1119949351 14:78728585-78728607 TCAGACAAAACTGGATTTGTGGG + Intronic
1121764118 14:96470677-96470699 ACAGAGAAAAGTGCCTTTGAGGG + Intronic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123774458 15:23565478-23565500 GCAGACAAAAGGGGCTGGGTTGG + Intergenic
1124216072 15:27808019-27808041 GCAGACACAGGTGCCTTTACAGG + Intronic
1125056286 15:35361264-35361286 ACAGACGAAAATGCCCTTGTGGG - Intronic
1125426828 15:39557141-39557163 GCATCCAAAGGTGCCTTTGGGGG - Intergenic
1126286432 15:47018335-47018357 ACAGACAAAAATCTCTTTGTGGG + Intergenic
1126372929 15:47965849-47965871 CCAGCCCAAAGTGCATTTGTGGG - Intergenic
1126606954 15:50487585-50487607 GAAAACTAAAGTGTCTTTGTTGG + Intronic
1128051853 15:64671742-64671764 GCAGTCACAAGTTTCTTTGTTGG + Intronic
1130718592 15:86363193-86363215 GCAGACAAAAGTGCCTTTGTAGG - Intronic
1130833890 15:87630661-87630683 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1131503372 15:92992745-92992767 GCAAAGAAAAGTGTCTTTGCAGG + Intronic
1131585758 15:93691000-93691022 GAAGAGAAATGAGCCTTTGTTGG + Intergenic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1134404513 16:13944512-13944534 TCAGTAAAAAGTGCCTTGGTCGG - Intronic
1134631889 16:15762334-15762356 GGAGACTAGACTGCCTTTGTAGG + Intronic
1135776180 16:25258624-25258646 ACAGACAAGAGTTCCTTTGGGGG - Intergenic
1137042404 16:35625301-35625323 GGAGACAAGACTGCCTTTGTAGG + Intergenic
1138732554 16:59211057-59211079 GCTTGCAAAATTGCCTTTGTAGG - Intergenic
1138825095 16:60309332-60309354 GGGGACTAAATTGCCTTTGTAGG - Intergenic
1139042598 16:63016055-63016077 GCAGGCAAGAGAGCTTTTGTAGG - Intergenic
1140726025 16:77813279-77813301 TCAGACAAAAATAACTTTGTTGG - Intronic
1142440025 16:90091810-90091832 GCAGGCAAAAGAGCTTGTGTAGG + Intronic
1143063561 17:4223900-4223922 GAAGACAAATGTGCTTCTGTTGG - Intronic
1144179937 17:12742302-12742324 GAAAACAAAAGAGCCTTTGGGGG + Intronic
1144281904 17:13734673-13734695 GCAGGCAAGAGTGCATGTGTAGG - Intergenic
1147481038 17:40762834-40762856 ACAGGCAAAAGTGCCTTTGTAGG - Intergenic
1148221803 17:45868150-45868172 GAGGACTAAACTGCCTTTGTAGG + Intergenic
1149286716 17:55173191-55173213 GCAGAAAAAAGTGACTTTTGGGG + Intergenic
1150868866 17:68882177-68882199 CCTGAAAAAACTGCCTTTGTAGG - Intronic
1151350097 17:73526749-73526771 GGAGACATAAGTGGGTTTGTGGG - Intronic
1151866014 17:76803404-76803426 GGAGACTAGACTGCCTTTGTCGG + Intergenic
1152957530 18:51743-51765 GCAGGCAAAAGAGCTTGTGTAGG - Intronic
1153186314 18:2490399-2490421 CAATACAAAAATGCCTTTGTAGG + Intergenic
1156169393 18:34463659-34463681 GGAGAGAAAAATGCTTTTGTGGG - Intergenic
1158789587 18:60761529-60761551 GCAGGCAAGAGAGCCTGTGTAGG - Intergenic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159963440 18:74573799-74573821 GCAGAGCAATGTGCCTTTGTGGG - Intronic
1162878326 19:13637697-13637719 ACAAACAAAAATGTCTTTGTGGG + Intergenic
1162881521 19:13663201-13663223 TCAGAGAAAAATGCCTTGGTTGG - Intergenic
1163241555 19:16067019-16067041 GCAGAGAAAAGTGTGTGTGTGGG + Intronic
1163720127 19:18894832-18894854 GCAGAGAAAGGCCCCTTTGTTGG + Intronic
1163787808 19:19285485-19285507 GCAGACATAAGTGCCCTATTGGG + Intronic
1163911858 19:20202787-20202809 CCTGACAAAAATGCCTTTATTGG + Intergenic
1164760128 19:30722395-30722417 GCAGCCACAAGTCCCTCTGTAGG - Intergenic
1165654293 19:37520018-37520040 TCAGACACAAGGGTCTTTGTGGG + Intronic
1166497980 19:43318567-43318589 GGGGACAAGACTGCCTTTGTGGG - Intergenic
925294956 2:2770114-2770136 GCAGGCAAGAGTGCCTATCTGGG - Intergenic
926352656 2:12010993-12011015 GTTGGTAAAAGTGCCTTTGTAGG + Intergenic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
930133157 2:47873565-47873587 AGAGACACAAGTGCCTTTGAGGG - Intronic
930248902 2:49013572-49013594 GCAGGTAGAAGTGCCTTTGGAGG + Intronic
931396816 2:61895267-61895289 ACAGATAAAAGTACCTCTGTTGG + Intronic
932908878 2:75784625-75784647 GGAGACTAGACTGCCTTTGTAGG - Intergenic
934106951 2:88703622-88703644 GGAGAAAAAAGTGGTTTTGTGGG - Intronic
934670951 2:96212407-96212429 GGAGACTAGACTGCCTTTGTAGG + Intergenic
935598630 2:104899704-104899726 ACAGACATAATTACCTTTGTTGG - Intergenic
939111416 2:138012712-138012734 GAAGACAGAATTGCCATTGTTGG - Intronic
939377029 2:141381891-141381913 ACAGACTAAAGTCTCTTTGTGGG + Intronic
940199066 2:151130105-151130127 GCAGGCAAAAGAGCTTGTGTAGG + Intergenic
940408751 2:153335855-153335877 GGAGAAAAAAGTGGTTTTGTGGG + Intergenic
941034722 2:160555730-160555752 GCAGGCAAAAGAGCTTGTGTAGG + Intergenic
941261024 2:163297392-163297414 GCATACAAAAGCCCCTTTGATGG + Intergenic
942223708 2:173796329-173796351 GGGGACTAAACTGCCTTTGTAGG + Intergenic
943348388 2:186769114-186769136 AAAGGCAAAAGTGGCTTTGTGGG + Intergenic
943595974 2:189856975-189856997 GTAGACAAAAGAGGCTTTGATGG + Intronic
944084115 2:195824559-195824581 GAAGACAAAAGTAATTTTGTAGG - Intronic
944121450 2:196244906-196244928 GCAGTGAACAGTGCCTTTATAGG + Intronic
944211756 2:197213036-197213058 GCAGGCCAAAGTGGCTGTGTTGG + Intronic
945468147 2:210195439-210195461 GCAAACAAAAGTGGAATTGTTGG + Intronic
945535386 2:211011270-211011292 GCATACAAAAGGGACTTTGCAGG + Intergenic
946829925 2:223718206-223718228 GGAGACTAGACTGCCTTTGTAGG + Intergenic
947572301 2:231245789-231245811 GCAGTTGAAAGTGCCTTGGTTGG + Intronic
947688616 2:232113819-232113841 GAAGACTAGATTGCCTTTGTAGG + Intronic
948810261 2:240471698-240471720 ACACACAAAAGTGCCTTCGTGGG + Intergenic
1168941840 20:1719371-1719393 GGAGACTAGAATGCCTTTGTAGG - Intergenic
1169834070 20:9858397-9858419 GCAGACAGAAGTGCATTCATGGG - Intergenic
1170448663 20:16458140-16458162 GCAGCCATCAGTGCCTTTGTGGG - Intronic
1170936288 20:20812716-20812738 GGAGACTAGACTGCCTTTGTAGG - Intergenic
1171218182 20:23368653-23368675 GAACTCAAAAGTGCCTTGGTAGG - Intronic
1171817618 20:29802313-29802335 GCAGGCAAAAGGGCTTGTGTAGG - Intergenic
1171900717 20:30853778-30853800 GCAGGCAAAAGGGCTTGTGTAGG + Intergenic
1172795776 20:37536277-37536299 GGAGACTAGATTGCCTTTGTAGG + Intergenic
1173349300 20:42230535-42230557 GCTGACAAAAATGCCTCTCTGGG - Intronic
1174042133 20:47707561-47707583 GCAGCCACTGGTGCCTTTGTGGG - Intronic
1176783371 21:13226519-13226541 GGAGGAAAAAGTGTCTTTGTGGG + Intergenic
1176980923 21:15380055-15380077 TAAGACAAAAGTGGCTTTGTAGG + Intergenic
1177139660 21:17344544-17344566 GGAGAAAAAAGTGGTTTTGTGGG + Intergenic
1177420605 21:20852041-20852063 GGGGACAAGACTGCCTTTGTAGG - Intergenic
1178167363 21:29994928-29994950 CCAGATAAAAGTGACTTTTTTGG + Intergenic
1180320955 22:11320984-11321006 GCAGGCAAAAGGGCTTGTGTAGG - Intergenic
1180334088 22:11559761-11559783 GCAGGCAAAAGGGCTTGTGTAGG + Intergenic
1180965963 22:19788103-19788125 GCAGAGAAAGGTGCCTGTGAGGG - Exonic
1182454539 22:30441545-30441567 GGAGACTAGACTGCCTTTGTAGG - Intergenic
1182837059 22:33350712-33350734 GCAGACAAAAGAGCAATAGTGGG - Intronic
1182978866 22:34649200-34649222 GAAGACAAAACTGCCTCTGGTGG - Intergenic
1183087790 22:35497546-35497568 ACAGAGAAAAGTGACTTTGAAGG - Intergenic
1183121882 22:35736415-35736437 GCAGACAGAAGTGCCTCAGGGGG + Intergenic
1184259104 22:43304547-43304569 GCAGAGAAAGGTGCATTTGGTGG + Intronic
1184677303 22:46050766-46050788 CCAGACCAAAGGGACTTTGTAGG - Exonic
1184851021 22:47120677-47120699 ACAGACAAAATGGCCCTTGTAGG + Intronic
1185044133 22:48520534-48520556 GCACCCAGCAGTGCCTTTGTTGG + Intronic
949285720 3:2401878-2401900 GCAAACAAAATTGCTTTTGTAGG - Intronic
949698103 3:6722385-6722407 GCAGACAAGAGGGCTTGTGTAGG + Intergenic
949993608 3:9599738-9599760 GGAGACTATATTGCCTTTGTAGG - Intergenic
950357050 3:12420481-12420503 TCAGAAAGAAGTGCTTTTGTTGG + Intronic
951290008 3:20863558-20863580 GGAGACAAAAATGGATTTGTGGG - Intergenic
952801692 3:37298567-37298589 GGAGACTAGATTGCCTTTGTAGG - Intronic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
955843080 3:63132676-63132698 ACAAGCAAGAGTGCCTTTGTGGG + Intergenic
956840309 3:73134125-73134147 GGGAAGAAAAGTGCCTTTGTAGG + Intergenic
957461685 3:80529939-80529961 GGAGACTAGACTGCCTTTGTAGG + Intergenic
958563771 3:95781429-95781451 GGAGACAAAAATGGTTTTGTGGG + Intergenic
960006559 3:112787212-112787234 GCAGATTAGATTGCCTTTGTGGG + Intronic
962293475 3:134158042-134158064 GAAGACAAATGTGCTTCTGTTGG + Exonic
963160674 3:142148723-142148745 TCAGAGAAAAGTTCCTTTATGGG + Intronic
963314215 3:143741973-143741995 GGAGACTAGATTGCCTTTGTAGG + Intronic
963363528 3:144305495-144305517 ACAGACAAAAGTCTCTCTGTGGG - Intergenic
965691163 3:171358380-171358402 GCAGACAAGAATGCTTGTGTAGG + Intronic
967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG + Intergenic
967689504 3:192457875-192457897 GGAGAAAAAAGTGGTTTTGTGGG + Intronic
970415463 4:15852440-15852462 GCACAGAAAACTGCTTTTGTGGG + Exonic
970895812 4:21102752-21102774 GTAAACAAAGCTGCCTTTGTTGG + Intronic
972346326 4:38195529-38195551 GCAGTCAATTGTACCTTTGTTGG - Intergenic
972743778 4:41913484-41913506 GGGGACAAGAATGCCTTTGTAGG + Intergenic
972847119 4:43004033-43004055 GGAGAGAAAACTGCTTTTGTGGG + Intronic
973695116 4:53483199-53483221 GCAGACAAGAGAGCCTGTGCAGG - Intronic
974083447 4:57235540-57235562 GCAGACAAGAGAGCATGTGTAGG - Intergenic
974427699 4:61761237-61761259 GGAGACTAGATTGCCTTTGTAGG - Intronic
974455822 4:62128410-62128432 GGAGAAAAAAGTGACTTTGTTGG + Intergenic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
974915461 4:68173431-68173453 GGAGAAAAAAGTGGTTTTGTGGG + Intergenic
975201112 4:71590687-71590709 ACAGACAAAAGTACCTATGCGGG - Intergenic
975632376 4:76416546-76416568 GGAGAAAAAAGTGGTTTTGTGGG + Intronic
975900744 4:79149262-79149284 GCAGTCAGAAGTGCCTTTGTGGG - Intergenic
976994364 4:91412053-91412075 GAAAAGAAAAGTGACTTTGTAGG + Intronic
977509932 4:97950827-97950849 GGAGACTAGATTGCCTTTGTAGG + Intronic
977610442 4:99024755-99024777 GGAGACCAGACTGCCTTTGTGGG - Intronic
978461776 4:108962937-108962959 GCAAACAAGACTGGCTTTGTAGG - Intronic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
980832875 4:138152880-138152902 GCGGACTAGACTGCCTTTGTAGG - Intergenic
981213883 4:142139812-142139834 GCAGACAGCTGTGCGTTTGTCGG + Intronic
982395610 4:154912056-154912078 ACAGACAAAAGTGCCTTTAAGGG - Intergenic
982778422 4:159465775-159465797 ATAGACAAAAGTTTCTTTGTGGG - Intergenic
983340466 4:166454600-166454622 GGAGAAAAAAGTGGTTTTGTGGG + Intergenic
983410079 4:167385569-167385591 CCAGACAAAAGTACTCTTGTGGG + Intergenic
983899398 4:173117624-173117646 GCAGACAAGAGAGCTTGTGTAGG - Intergenic
984791496 4:183619241-183619263 GCAGACAACAGTGCGTCTTTTGG + Intergenic
985441798 4:189987054-189987076 GCAGGCAAAAGAGCTTGTGTAGG - Intergenic
986574346 5:9196949-9196971 GCTGACAAAAGGCCCTTTCTGGG + Intronic
987197627 5:15543272-15543294 GCAGACAAGAGGGCATGTGTAGG + Intronic
988038884 5:25862338-25862360 GCAGAAAAAAGAGCTTTTGTAGG + Intergenic
988075335 5:26345758-26345780 GCAAACACAAGTGCCTTTTTAGG + Intergenic
988129161 5:27080330-27080352 GGAGGAAAAAGTGCTTTTGTGGG - Intronic
988316974 5:29643779-29643801 GGAGGCAAAAGTGGTTTTGTGGG + Intergenic
989358208 5:40568730-40568752 GCAGATAAAAGTGGAATTGTTGG - Intergenic
989627907 5:43449657-43449679 GTACATAAAAGTGCTTTTGTTGG - Intronic
992130307 5:73685484-73685506 TCAGACAAAACTTCCTTTCTTGG + Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
995581097 5:113603481-113603503 GCAGGCAAGAGTGCCTGTGCAGG - Intergenic
995750648 5:115450349-115450371 GCTGACATACGTGCCTTTTTGGG + Intergenic
995816715 5:116177542-116177564 GCAGAATAATGTGACTTTGTAGG + Intronic
995881528 5:116849365-116849387 GAAGCCAAAAGTGCATGTGTAGG + Intergenic
996150633 5:120030151-120030173 AGAGGCAAAAGTGCCTGTGTGGG - Intergenic
997925554 5:138027880-138027902 GCAGGCAAGAGAGCCTTTGTAGG - Intronic
998244527 5:140486838-140486860 GGAAACAAAAGTGCATTTGGTGG + Intronic
998331367 5:141330799-141330821 ACAGACAAAGGTTCCTTCGTAGG + Exonic
998593563 5:143503359-143503381 TCAGACACATGTGCCTTTCTGGG - Intergenic
1001966851 5:175915849-175915871 GCAAACAAGAGTTCCTGTGTGGG + Intergenic
1002199798 5:177521330-177521352 TCAGACAAAAGGACCTGTGTGGG + Intronic
1002250096 5:177923357-177923379 GCAAACAAGAGTTCCTGTGTGGG - Intergenic
1002835780 6:864110-864132 GCTTTCAAAAGTGCCTTTTTTGG + Intergenic
1003551495 6:7106243-7106265 GCAGACAGAAGTGTCTGTCTCGG - Intergenic
1006748028 6:36358635-36358657 GGAGAAGAAAGTGCCTTTGTTGG + Intronic
1007206578 6:40157273-40157295 GAAGACAAAACTGCATTTCTAGG + Intergenic
1007467017 6:42059627-42059649 GGAGACTAGATTGCCTTTGTAGG - Intronic
1008115407 6:47543735-47543757 TCTGGCAATAGTGCCTTTGTGGG - Intronic
1008650060 6:53552718-53552740 GGAGAAAAAAGTGGTTTTGTGGG + Intronic
1009625775 6:66137647-66137669 GGGGACTAAATTGCCTTTGTAGG + Intergenic
1009949159 6:70375759-70375781 GCAGACAAGAGAGCTTCTGTAGG - Intergenic
1010802862 6:80198120-80198142 GCAGACCATACTGTCTTTGTTGG + Intronic
1010920408 6:81673385-81673407 GGAGAAAAAAGTGGTTTTGTGGG - Intronic
1011708422 6:90026605-90026627 GCAGACAAAAGTGTGTCTGGAGG - Intronic
1015051830 6:128850300-128850322 GCAGAGATAAGTCCCTTTGCTGG - Intergenic
1016175727 6:141075647-141075669 CAAGACAAAAGTGCCTATGCTGG + Intergenic
1017530962 6:155291783-155291805 TAAGGCAAAAGTGCCCTTGTTGG + Intronic
1017785569 6:157754206-157754228 GGAGACTAGATTGCCTTTGTAGG - Intronic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1018802306 6:167233527-167233549 GAAGACTAAATTGCCTTTGTAGG + Intergenic
1018807048 6:167269913-167269935 GCAGGAAAAAGTGCCATTATTGG - Intergenic
1018866940 6:167753536-167753558 GGAGGCAAAAGTGGTTTTGTGGG - Intergenic
1020840254 7:13208807-13208829 AAAGACAAAAGTGCCTTTCTGGG - Intergenic
1020921577 7:14271581-14271603 GCAGACAATGGAGCCTTTGAGGG + Intronic
1022330905 7:29377924-29377946 GCAACCAAATATGCCTTTGTTGG - Intronic
1023293203 7:38688673-38688695 GCAGGCAAGAGTGCATTTGCAGG + Intergenic
1024760640 7:52592972-52592994 GCAGACGACATTGCATTTGTAGG - Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1026867140 7:73830857-73830879 GGCCTCAAAAGTGCCTTTGTTGG + Exonic
1029642779 7:101831691-101831713 GAAGACAGAAGTGACTCTGTGGG - Intronic
1029649325 7:101879973-101879995 GCAGAGAAAGGTGGCTTTGCTGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031293849 7:119976777-119976799 GCAGACACAGGTGTATTTGTGGG + Intergenic
1031790256 7:126093506-126093528 GCAGACAAAAGAGCATGTGCAGG + Intergenic
1032454010 7:132058213-132058235 GGAGAAAAAAGTGGTTTTGTGGG + Intergenic
1033627557 7:143125405-143125427 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1035716835 8:1761969-1761991 GGAGACTAGACTGCCTTTGTAGG - Intronic
1037134277 8:15443677-15443699 GGAGACTAGACTGCCTTTGTAGG + Intronic
1037406668 8:18549569-18549591 ACAGACAAGAGTACATTTGTGGG - Intronic
1037528119 8:19747588-19747610 GCAGAAAATAGTCACTTTGTTGG - Intronic
1038331971 8:26616302-26616324 GGAGAGATAAGAGCCTTTGTGGG - Intronic
1039259128 8:35751414-35751436 GGAGACTAGATTGCCTTTGTAGG - Intronic
1040009949 8:42653057-42653079 GGAGATAAAAGTGGCTTGGTTGG - Intergenic
1040535893 8:48309465-48309487 ACAGTCAAAAGTGCCTCTGTGGG + Intergenic
1042071661 8:64941650-64941672 GGAGGAAAAAATGCCTTTGTGGG - Intergenic
1042869717 8:73387203-73387225 GTAGATGAAAGTGTCTTTGTGGG + Intergenic
1043708910 8:83389178-83389200 GCAGATAAAAGTACCTTGGAGGG - Intergenic
1044155864 8:88845986-88846008 GCAGCCAAAACTGCCATAGTTGG - Intergenic
1045811888 8:106231534-106231556 AAAGACAAAAATGCCTTTGTGGG + Intergenic
1045911509 8:107416014-107416036 GCAGAGAAAAGAGAGTTTGTGGG - Intronic
1047963746 8:130030067-130030089 GCAGATAAAAGTGACTTTTATGG - Intergenic
1048843706 8:138586900-138586922 GCAGACAACAGAGACTTTTTAGG + Intergenic
1050643361 9:7692945-7692967 GGAGAAAAAAGTGGTTTTGTTGG + Intergenic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1052116367 9:24652394-24652416 GGGAAAAAAAGTGCCTTTGTGGG - Intergenic
1052351811 9:27465902-27465924 GCAGGAAAAAGTGGTTTTGTGGG - Intronic
1055865014 9:80802807-80802829 GCAGATAAAACTGTCTTTATGGG - Intergenic
1056451264 9:86719160-86719182 CCAATCAAAAGTGCCTTTGAGGG + Intergenic
1056458883 9:86790251-86790273 GCAGAAACAAGTGGCTTTGAAGG + Intergenic
1056905010 9:90638930-90638952 TCAGACAAAGGAGCCTTTGAAGG - Intronic
1056976540 9:91261401-91261423 GCAGATTAAAGAGGCTTTGTAGG - Intronic
1057366413 9:94425733-94425755 GGAGACTAGACTGCCTTTGTAGG - Intronic
1057656920 9:96962332-96962354 GGAGACTAGACTGCCTTTGTAGG + Intronic
1058322325 9:103649138-103649160 GGAGAATAAGGTGCCTTTGTGGG + Intergenic
1058537229 9:105974819-105974841 GCAGACAAGAGTGGCTCTGAAGG - Intergenic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1062740613 9:138172827-138172849 GCAGGCAAAAGAGCTTGTGTAGG + Intergenic
1203369176 Un_KI270442v1:286759-286781 GCAGGCAAAAGGGCTTGTGTAGG - Intergenic
1185893601 X:3840580-3840602 GGAGAAAAAAGTGGTTTTGTGGG + Intronic
1185898716 X:3879004-3879026 GGAGAAAAAAGTGGTTTTGTGGG + Intergenic
1185903833 X:3917433-3917455 GGAGAAAAAAGTGGTTTTGTGGG + Intergenic
1186042303 X:5494301-5494323 GCAGAAAAAAGAGCATGTGTAGG - Intergenic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1187641834 X:21299885-21299907 GAAGACAAAGGTGCCATGGTTGG - Intergenic
1187962606 X:24581095-24581117 GCAGACAAAAATGACATTGCTGG - Intronic
1188993641 X:36855027-36855049 GCAGAGAAAACTGCTTTTGGTGG + Intergenic
1189409410 X:40756339-40756361 ACAGACAAAAGTGTCTTTGTGGG - Intergenic
1189903576 X:45734471-45734493 GAAGAGAAAAATGGCTTTGTGGG + Intergenic
1190774699 X:53543427-53543449 ACAGACAGAAGTGGCTGTGTGGG + Intronic
1191198860 X:57755757-57755779 ACAGCCCAAAGTGCCTATGTTGG + Intergenic
1191674413 X:63779405-63779427 GCAGACAAGAGAGCCTGTGCAGG + Intronic
1192013221 X:67298565-67298587 ACAGACAAAAGTGCCTTCTTGGG + Intergenic
1192178478 X:68900678-68900700 GCTGACAAAGGAGCTTTTGTGGG - Intergenic
1192299512 X:69885622-69885644 ACAGACAAAATTGTCTTTGTAGG + Intronic
1193614524 X:83671395-83671417 GGAGAAAAAAGTGATTTTGTGGG + Intergenic
1193950349 X:87789334-87789356 GCAGGCAAGAGTGCATATGTAGG + Intergenic
1194496377 X:94621553-94621575 GCAGGAAAAAGTGGTTTTGTGGG - Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1194718290 X:97311764-97311786 GGAGACTAGACTGCCTTTGTAGG - Intronic
1195727261 X:107931360-107931382 TCAGACAAAACTGCCTTTTATGG + Intergenic
1196963557 X:121030429-121030451 GGTGACTAAACTGCCTTTGTAGG - Intergenic
1199027485 X:142956951-142956973 ACAGTCAAAAGTGCCTTTATGGG - Intergenic
1199042195 X:143127167-143127189 GCAGGAAAAAGTGGTTTTGTGGG + Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1201069103 Y:10128202-10128224 GCAGGCAAAAGGGCTTGTGTAGG + Intergenic