ID: 1130722556

View in Genome Browser
Species Human (GRCh38)
Location 15:86403743-86403765
Sequence ACAGCTGGTGTTACAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130722556 Original CRISPR ACAGCTGGTGTTACAGAGCC AGG Intronic
901021319 1:6257407-6257429 CCAGCTGGTCTTCCAGAGCCAGG + Intronic
902164338 1:14557839-14557861 CCAGCTCCTGCTACAGAGCCTGG + Intergenic
902933747 1:19749395-19749417 CCAGCTTGGGTGACAGAGCCAGG - Intronic
904468180 1:30720073-30720095 ACAGCTAGATTTTCAGAGCCAGG - Intronic
905093564 1:35449582-35449604 ACAGCAGTTGTGTCAGAGCCAGG - Intronic
905364482 1:37441940-37441962 ACATCTAATTTTACAGAGCCTGG - Intergenic
905736248 1:40328423-40328445 CCAGCCAGTGTGACAGAGCCAGG - Intergenic
906743750 1:48207379-48207401 ACAGCTGCTCTGACAGTGCCAGG - Intergenic
907273233 1:53302929-53302951 ACAGCAGGTGATCCAGAGTCAGG + Intronic
909571329 1:77115205-77115227 AGAGCTAGAATTACAGAGCCCGG + Intronic
911149103 1:94580088-94580110 ACAGCTGCTTTGCCAGAGCCTGG - Intergenic
911340780 1:96633851-96633873 CCAGCTAGGGTGACAGAGCCAGG - Intergenic
911348886 1:96728017-96728039 CCAGCTGGGGTGACAGAGTCAGG - Intronic
912363140 1:109111438-109111460 CCAGCTGGGGTGACAGAGCAAGG + Intronic
912406433 1:109442334-109442356 ACAGCTCCTGTCACAGAGTCAGG + Intergenic
915636927 1:157194103-157194125 TCAGCTGGTCTGAGAGAGCCGGG - Intergenic
916189889 1:162168451-162168473 GCAGCTGATGTCACAAAGCCTGG - Intronic
916716779 1:167453327-167453349 ACAGCTCATGTGTCAGAGCCTGG + Intronic
917553494 1:176059016-176059038 AGTGCTGGTGTTACAAAGCAAGG - Intronic
918115396 1:181491919-181491941 ACACCTGGTCTTACAGGTCCTGG - Intronic
919914797 1:202132727-202132749 ACAGCTGCTGCCTCAGAGCCTGG - Exonic
920712229 1:208306258-208306280 ACAGCTGGTGATGCGGACCCAGG + Intergenic
920721282 1:208389386-208389408 CCAGCTTGGGTGACAGAGCCAGG - Intergenic
921125638 1:212175332-212175354 ACAGCTGGAGTGACAGGGCAGGG + Intergenic
922483882 1:225958362-225958384 AGAGCTGGGGATACAAAGCCCGG + Intergenic
922992701 1:229928882-229928904 ACAGCTGATGTTACAGTGGGAGG - Intergenic
1062831997 10:611774-611796 TCAGCTGGTGTTTGAGGGCCAGG - Intronic
1062906523 10:1183273-1183295 ACAGCTGCTGTTTCACAGACTGG + Exonic
1065417458 10:25503918-25503940 CCAGCTGGGGTGACAGAGCGAGG - Intronic
1066200826 10:33141561-33141583 CCAGCAGTGGTTACAGAGCCTGG + Intergenic
1067468850 10:46521936-46521958 AGAGCTGGTGTTAAAGAGCTAGG - Intergenic
1067792703 10:49299846-49299868 ACAGCTGGTGTGACCCTGCCTGG - Intronic
1068070030 10:52183731-52183753 ACAGCTTGGCTTACAAAGCCTGG + Intronic
1068445532 10:57117701-57117723 AGAGCTCGTGGTACAGTGCCTGG - Intergenic
1069561228 10:69431370-69431392 CCAGCCTGGGTTACAGAGCCAGG - Intergenic
1070584309 10:77750024-77750046 ATAGCTGGGGTTACAGAGATGGG - Intergenic
1070820035 10:79349100-79349122 ACAGCTGGTAAGACAGGGCCTGG + Exonic
1071518434 10:86314466-86314488 TCAGCTGTGCTTACAGAGCCTGG + Intronic
1073329418 10:102660954-102660976 ACAGCTGCTCCTACAAAGCCAGG - Intergenic
1073476660 10:103758078-103758100 ACAGATGATGCTACAGAGCCTGG + Intronic
1074192132 10:111147328-111147350 ACAGCAAGTGATACAGAGTCTGG + Intergenic
1075520243 10:123139227-123139249 ACAGATTGGGTGACAGAGCCAGG - Intergenic
1076063194 10:127429177-127429199 CCAGCTGGTGCTACAGAGAAGGG - Intronic
1076223035 10:128749960-128749982 ACACCTGGTGTTAAGGAGCTCGG + Intergenic
1076510180 10:131007958-131007980 ACAGCTGTGGTTTCAGAGCCGGG - Intergenic
1076618490 10:131771980-131772002 GCAGCTGGGGGCACAGAGCCTGG + Intergenic
1076847614 10:133077004-133077026 GCAGCTGGTGCCACAGAGACGGG - Intronic
1077815817 11:5684467-5684489 AAGGCTGATGTCACAGAGCCAGG + Intronic
1077958651 11:7049047-7049069 AAAGGTGGTGTTACAAAGCGAGG + Intronic
1078096149 11:8298441-8298463 GCAGTGGGTGTTACAGCGCCGGG + Intergenic
1079580353 11:22055919-22055941 ACAGCTGCTGTGACAGATCGTGG - Intergenic
1084362580 11:68678343-68678365 ACAGCTCGTGTTCCAGTGCTAGG + Intergenic
1084654860 11:70509255-70509277 ACAGCTGGTGCTGCAGGGGCAGG - Intronic
1085252247 11:75151504-75151526 ACAGCTGTTGGCACAGAGCCAGG + Intronic
1086332878 11:85771476-85771498 ACAACTGTTGTTTCAGAGCTGGG + Intronic
1090027022 11:123176605-123176627 CCAGCTGGTGCTAAGGAGCCAGG - Intronic
1091235330 11:134018376-134018398 ACAGTTGGAGGGACAGAGCCAGG - Intergenic
1091630193 12:2154249-2154271 CCAGCTTGTGCTGCAGAGCCTGG + Intronic
1094599715 12:31898031-31898053 GCAGCAGGAGCTACAGAGCCGGG - Intergenic
1096333208 12:50732933-50732955 CCAGCTGGGGTGACAGAGCAAGG - Intronic
1097598513 12:61664093-61664115 ACAGCTACTGTTACAGATCGTGG - Intergenic
1098137081 12:67414153-67414175 TCAGCAGGTGTTACAGATCCGGG + Intergenic
1098282561 12:68876355-68876377 AAATCTGCTGTTACAGAGGCAGG - Intronic
1100424679 12:94473178-94473200 ACAGCAGGGGTAATAGAGCCAGG - Intergenic
1101409200 12:104455388-104455410 ACACTTGGCTTTACAGAGCCAGG - Intronic
1101755057 12:107614909-107614931 AGAGCTGGTGATACAGGGCAGGG - Intronic
1101960971 12:109249754-109249776 ACTGCTGGGATTACAGAGCAGGG + Intronic
1102215049 12:111154943-111154965 ACAGCAGCAGTGACAGAGCCAGG - Intronic
1104979073 12:132565023-132565045 ACAGGTCGTGTTACAGATCAGGG + Intronic
1105030869 12:132882733-132882755 ACAGCTGGGGTAACAGCGCAAGG - Intronic
1106187204 13:27420024-27420046 AGAGCTGGTTTAAGAGAGCCTGG + Intergenic
1106932829 13:34685101-34685123 CCAGCCTGTGTGACAGAGCCAGG + Intergenic
1108017098 13:46087048-46087070 CCAGCTGGGGTTGCAGACCCAGG - Intronic
1109313474 13:60722194-60722216 ACAGCAGGGTTTACAGAGACAGG - Intergenic
1112978508 13:105351843-105351865 ACAGCTTGGGTGACAGAGCAAGG + Intergenic
1117658347 14:57979423-57979445 CCAGCTGGTGTCACAGTGACTGG + Intronic
1117867022 14:60160611-60160633 CCAGCTTGGGTGACAGAGCCAGG - Intronic
1118451260 14:65904626-65904648 ACAGATTTTGTTCCAGAGCCAGG - Intergenic
1118596035 14:67436418-67436440 AGAGCTGGTATTGCAGGGCCAGG - Intergenic
1123832850 15:24159450-24159472 ACAGCTAGTTTTACATACCCAGG - Intergenic
1123868495 15:24547664-24547686 ACAGCTAGTTTTACATACCCAGG - Intergenic
1125277792 15:38011575-38011597 TCAGCAGGTGATAAAGAGCCAGG - Intergenic
1126456368 15:48866435-48866457 CCAGCTGCTGGCACAGAGCCTGG - Intronic
1127474264 15:59317783-59317805 AATGCTGGTGTGACAGAGCGAGG + Intronic
1129020633 15:72514439-72514461 AGTGCTGGGATTACAGAGCCCGG - Intronic
1129207897 15:74048120-74048142 CCAGCAGCTGTCACAGAGCCTGG + Intergenic
1130722556 15:86403743-86403765 ACAGCTGGTGTTACAGAGCCAGG + Intronic
1131335998 15:91549609-91549631 ACTTGTGCTGTTACAGAGCCAGG + Intergenic
1132178824 15:99736055-99736077 ACAGCTGGTGGCTGAGAGCCAGG - Intergenic
1134606183 16:15573108-15573130 ACAGCTGGTCTTACTGTGCCAGG - Intronic
1134665549 16:16015935-16015957 ACAGCCAGTGTGAGAGAGCCAGG + Intronic
1136393270 16:29978521-29978543 ACAGCCTGTGTCACTGAGCCAGG - Intronic
1136519446 16:30786673-30786695 CCCGCTGCTGATACAGAGCCTGG + Intronic
1138652829 16:58471568-58471590 AAACCTGGTCTCACAGAGCCAGG + Intronic
1139842292 16:69891280-69891302 ACCCCTGGTGTTCCAGAGTCAGG + Intronic
1140808859 16:78557991-78558013 ACTGCTGCTTTTTCAGAGCCTGG + Intronic
1142903514 17:3027560-3027582 GCAGCTGGGTTCACAGAGCCAGG + Intronic
1143526093 17:7473522-7473544 AGTGCTGGGATTACAGAGCCTGG + Intronic
1144411824 17:15009127-15009149 ACAGCTGGAGAGACAGACCCTGG + Intergenic
1146843081 17:36168175-36168197 ACAGCAGGTGTGAAAGAACCTGG + Intronic
1146855386 17:36256116-36256138 ACAGCAGGTGTGAAAGAACCTGG + Intronic
1146865235 17:36332259-36332281 ACAGCAGGTGTGAAAGAACCTGG - Intronic
1146871292 17:36380027-36380049 ACAGCAGGTGTGAAAGAACCTGG + Intronic
1146878652 17:36431109-36431131 ACAGCAGGTGTGAAAGAACCTGG + Intronic
1146882600 17:36452255-36452277 ACAGCAGGTGTGAAAGAACCTGG + Intergenic
1147068095 17:37932853-37932875 ACAGCAGGTGTGAAAGAACCTGG - Intronic
1147074178 17:37980651-37980673 ACAGCAGGTGTGAAAGAACCTGG + Intronic
1147079625 17:38012408-38012430 ACAGCAGGTGTGAAAGAACCTGG - Intronic
1147085700 17:38060189-38060211 ACAGCAGGTGTGAAAGAACCTGG + Intronic
1147095566 17:38136350-38136372 ACAGCAGGTGTGAAAGAACCTGG - Intergenic
1147101647 17:38184155-38184177 ACAGCAGGTGTGAAAGAACCTGG + Intergenic
1147236650 17:39062677-39062699 ACATCTGGTGTTATTGCGCCAGG + Intergenic
1147878750 17:43640633-43640655 CCAGCTGGTGTTGCAGAGGGAGG - Exonic
1149846245 17:60010661-60010683 ACAGCAGGTGTGAAAGAACCTGG + Intergenic
1150084594 17:62267240-62267262 ACAGCAGGTGTGAAAGAACCTGG + Intergenic
1150217181 17:63477268-63477290 ACAGGTGCTGTTCCAGAGCGTGG + Intergenic
1154510869 18:15100001-15100023 CCAGCTTGGGTGACAGAGCCAGG + Intergenic
1156191331 18:34724611-34724633 AGAGCTGGTTTAAAAGAGCCTGG - Intronic
1158717058 18:59889743-59889765 AGAGATGGGGTTTCAGAGCCTGG - Intergenic
1159938457 18:74387199-74387221 GCAGCTGGTGTCCCATAGCCTGG - Intergenic
1162121437 19:8471839-8471861 ACAGCTGCTGCTAGAGAGCTAGG + Intronic
1162578592 19:11513921-11513943 GCAGCTGGTTGTACACAGCCAGG + Exonic
1162939865 19:14002670-14002692 CCTGCTTGTGCTACAGAGCCAGG + Intronic
1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG + Intronic
1165411639 19:35665902-35665924 CCAGCTTGAGTGACAGAGCCAGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166502085 19:43349183-43349205 AAAGCTGGAGTCACAAAGCCAGG - Intergenic
1166508027 19:43384269-43384291 AAAGCTGGAGTCACAAAGCCAGG + Intergenic
1166940895 19:46364903-46364925 CCAGCTGGTGTTTCGGGGCCGGG + Intronic
1167143011 19:47665115-47665137 ACAGCTGGTGGTTCTCAGCCAGG - Intronic
1168658636 19:58148837-58148859 ACAGCAGGTGTTGCAGAGGCAGG - Intronic
925156624 2:1653186-1653208 TCAGCTGGTTTCACAGACCCGGG + Intronic
925393802 2:3518534-3518556 AAAGCTAGCGTTACAGAGGCAGG + Intronic
928820218 2:35352904-35352926 ACAGCTAGTTTTATAGAGCCTGG - Intergenic
931457927 2:62426667-62426689 ACTGCTGGAGGCACAGAGCCTGG + Intergenic
931672414 2:64659434-64659456 ACAGCAGATGGTGCAGAGCCAGG + Intronic
932446588 2:71785571-71785593 ACAGCTGGTGGCAGAGGGCCGGG + Intergenic
932734101 2:74242215-74242237 AGGGCTGGTGGGACAGAGCCTGG + Intronic
935804225 2:106730203-106730225 CCAGCCGGTGTTAGAGAGGCAGG - Intergenic
936151228 2:110023393-110023415 ACAGCTGCAGAGACAGAGCCCGG + Intergenic
936193447 2:110347976-110347998 ACAGCTGCAGAGACAGAGCCCGG - Intergenic
936327971 2:111522027-111522049 TAAGCTGGGGTTACAGATCCAGG + Intergenic
936401334 2:112166746-112166768 ACAGATTGAGTTACAGACCCTGG + Intronic
937076126 2:119108245-119108267 CCAGCTGGGGCTGCAGAGCCTGG - Intergenic
937094574 2:119227041-119227063 TCAGCTGGTCTTAGAGTGCCTGG - Intronic
938074556 2:128324746-128324768 ACAGCTGGTTAGACAGAGCTGGG - Intergenic
938506085 2:131884460-131884482 CCAGCTTGGGTGACAGAGCCAGG + Intergenic
940119021 2:150242168-150242190 AGAGATGCTGTTACAGAGCTGGG - Intergenic
941392226 2:164928218-164928240 ACAGTGAGTGTTGCAGAGCCTGG + Intronic
943076010 2:183196102-183196124 ACAGCTGGACTCTCAGAGCCAGG - Intergenic
944402588 2:199345197-199345219 AGAGATGTTGTCACAGAGCCTGG - Intronic
946787623 2:223264449-223264471 ACAGTAGGTGTAACAGACCCAGG - Intergenic
948251059 2:236529498-236529520 ACAGCTAGTGTAGCAGAGCCAGG + Intergenic
1170597761 20:17818369-17818391 ACAGCTGCCGTGACTGAGCCAGG - Intergenic
1172177573 20:32981632-32981654 AAAGCTGGAGTCACAGAGCATGG + Intergenic
1172463380 20:35136896-35136918 ACAGTTGATGCTACTGAGCCTGG + Intronic
1172930157 20:38580794-38580816 ACAGCTGGTATTACAGGACCTGG + Intergenic
1173796397 20:45863661-45863683 ACAGATGGGGAGACAGAGCCAGG + Intronic
1174277838 20:49416735-49416757 ACAGCTTGAGTTCCAAAGCCAGG - Intronic
1175026464 20:55907702-55907724 ACAGCTTGGGTAACAGAGGCAGG + Intergenic
1175388049 20:58609786-58609808 ACAGCAGGTGTCACAGAGGAAGG + Intergenic
1176162142 20:63653408-63653430 ACGGCTGGTGCTGCAGTGCCGGG + Exonic
1176786986 21:13269277-13269299 CCAGCTTGGGTGACAGAGCCAGG - Intergenic
1176893834 21:14351812-14351834 ACAGCTTGGGTGACAGAGCCAGG - Intergenic
1177198634 21:17929796-17929818 CCAGCTGCTGTTGCAGTGCCAGG + Intronic
1179714144 21:43279159-43279181 GCAGCTGGTGTGGCAGAGGCAGG + Intergenic
1179886517 21:44316428-44316450 GCAGCTGGTGGTTCAGAGGCTGG + Exonic
1181949122 22:26541534-26541556 ACAGCAGGTGCTAGAGTGCCGGG - Exonic
1183167722 22:36160283-36160305 ACAGGAGGTGATCCAGAGCCTGG - Intronic
1183373398 22:37448538-37448560 ACAGCTGGTGTCACAGAGCAGGG + Intergenic
1183376668 22:37469462-37469484 ACAGCAGGTGCTGCAGACCCTGG + Exonic
1183472196 22:38015617-38015639 ATAGCTGCATTTACAGAGCCGGG - Intronic
1183725869 22:39589472-39589494 ACATCAGCTGTTTCAGAGCCTGG - Intronic
1183912223 22:41088485-41088507 ACAGCTTGGGTGACAGAGCAAGG + Intergenic
1184527301 22:45032538-45032560 AAAGCTAGTGCTACACAGCCAGG + Intergenic
951525510 3:23649030-23649052 ACAGCTTGTGTGGCAGAGCTGGG + Intergenic
951689078 3:25376484-25376506 CCAGGTGGTTTTACAGAGCAAGG - Intronic
952469405 3:33630328-33630350 ACAGCTAGTGTGGCAGAGCTGGG + Intronic
953356663 3:42262129-42262151 CCAACTGGTGTTCCAGGGCCTGG - Intronic
953420038 3:42747241-42747263 ACAGAAGGTCTTTCAGAGCCAGG - Exonic
955341613 3:58129615-58129637 CCAGCTGTTGTTAGAAAGCCAGG + Intronic
955503924 3:59612410-59612432 AAAGCTGGTGATATAAAGCCTGG - Intergenic
956555883 3:70521871-70521893 ATATCTGGTATTACAGAGCTTGG - Intergenic
957550035 3:81692106-81692128 AAACCAGGTGATACAGAGCCAGG + Intronic
958809543 3:98844732-98844754 ACTGCTGGTGTTACTGAGTGAGG - Intronic
960309617 3:116105196-116105218 ACAGCTGGTGATATACAGTCTGG + Intronic
961487904 3:127230025-127230047 ATAGCAGGTTTTACAGAGCCAGG + Intergenic
961560689 3:127726976-127726998 ACAGCTGGTGTTTTAGAACCAGG + Intronic
962638103 3:137351910-137351932 AGAACTTGTGTTACAGTGCCTGG + Intergenic
963979813 3:151525053-151525075 TCAGCTGGGGTGACAGAGCAAGG - Intergenic
964381395 3:156101517-156101539 GCAGCTAGTATCACAGAGCCAGG + Intronic
964711695 3:159677738-159677760 TCAGCTGGTCTTGCAGAGCCAGG - Intronic
964776764 3:160287581-160287603 ATAGCTGGTGTTTCATACCCTGG - Intronic
967182247 3:186916226-186916248 ACACGTTGTGTAACAGAGCCTGG - Intergenic
967881611 3:194305728-194305750 ACAGATGGGGTTACAGACACTGG - Intergenic
968061288 3:195727854-195727876 AAAGCTGGTGGTACACTGCCTGG - Intronic
968107160 3:196009318-196009340 ACAGCTGCTGCCACAGACCCAGG - Intergenic
969211950 4:5694834-5694856 ACAGCTGGAGGGGCAGAGCCAGG - Intronic
969266132 4:6065239-6065261 ACAGCTGGAGAGCCAGAGCCAGG - Intronic
970097027 4:12475817-12475839 ACAGCTGATGTGGCAGAGCTGGG - Intergenic
971255117 4:25007518-25007540 ACAGAGTGTGTTACAGAGCCGGG - Intronic
971542461 4:27836811-27836833 ACAGCTGATGAGACAGACCCTGG - Intergenic
972096263 4:35350456-35350478 ACAGCTGGAGTTAGAGACTCTGG + Intergenic
975093237 4:70427286-70427308 GCAGCTGGTGTTGCAGAGAGTGG - Intergenic
978533518 4:109737624-109737646 ACAGCTTGTACTGCAGAGCCTGG - Intergenic
979082784 4:116363344-116363366 ACACCTGGTGCAACTGAGCCTGG - Intergenic
981718295 4:147773994-147774016 AAAGCTGGAGTGGCAGAGCCAGG - Intronic
983114504 4:163796254-163796276 CCAGCCTGTGTGACAGAGCCAGG - Intronic
984021282 4:174487346-174487368 AAAGCTGGGGCTACAGAGCAGGG - Intergenic
988066551 5:26232962-26232984 ACAGCTGCTGCCACAGACCCAGG - Intergenic
989136949 5:38165528-38165550 ACAGCTTGTGTTCAGGAGCCAGG - Intergenic
990274007 5:54176082-54176104 ACAGCTGGAACTATAGAGCCTGG - Intronic
993952466 5:94193809-94193831 ACAGGAGGTGGTACAGAGCATGG - Intronic
995115844 5:108477994-108478016 GTAGCTGGTATTACAGAGCTGGG - Intergenic
995323620 5:110865731-110865753 ACAGCTGGTGTTAAAGGCCGAGG + Intergenic
997708182 5:135978366-135978388 CCATCTGGTGCTACAGAGACAGG + Intergenic
1001136996 5:169110924-169110946 ACAGCCCATGTTACAGAGCTCGG - Intronic
1001257566 5:170196023-170196045 ACAGCTGGGGAAACAGGGCCTGG + Intergenic
1001587483 5:172843373-172843395 AGAGCTGGGGTCCCAGAGCCTGG + Intronic
1002377094 5:178796590-178796612 ACAGCTGGTCACAGAGAGCCGGG + Intergenic
1002931278 6:1636869-1636891 AGAGCTTGTGCTACAGGGCCAGG - Intronic
1004064884 6:12234248-12234270 TCAGCTGGTAGTAGAGAGCCAGG + Intergenic
1005403839 6:25464314-25464336 ACATGTGGTGCTTCAGAGCCAGG + Intronic
1006219023 6:32472193-32472215 ACAGCATGGGTGACAGAGCCAGG + Intergenic
1006224883 6:32528911-32528933 ACAGCCTGGGTGACAGAGCCAGG + Intronic
1006916088 6:37594691-37594713 ACAGCTGGTGTGGCTGAGGCAGG - Intergenic
1006956245 6:37874868-37874890 AAGAATGGTGTTACAGAGCCAGG - Intronic
1011059842 6:83252321-83252343 CCAGCCTGTGTGACAGAGCCAGG - Intronic
1012375453 6:98556570-98556592 AAAGCTGTTGTCACAGTGCCTGG + Intergenic
1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG + Intergenic
1016551594 6:145286336-145286358 ACAGCTGGTCTAAGAGACCCTGG + Intergenic
1017500926 6:155022219-155022241 ACAGCTGTTGGTACAGAGCTCGG - Intronic
1017717592 6:157223345-157223367 CCCGCTGGTGTCACAGGGCCGGG + Intergenic
1017936957 6:159014352-159014374 AAAGCTGGTGGTACAGTTCCAGG + Intergenic
1018244134 6:161805759-161805781 ACAGCTGTTGATGGAGAGCCGGG + Intronic
1020979813 7:15053380-15053402 ACAGCTGGAGCTAGAGAGTCTGG + Intergenic
1023805026 7:43866863-43866885 CCAGCTGGTTTTAAAGCGCCGGG - Exonic
1025062198 7:55820027-55820049 ACAGCCTGGGTGACAGAGCCAGG - Intronic
1026033912 7:66817413-66817435 AGAGCTGGGGTCACAGGGCCAGG + Intergenic
1027955214 7:84870061-84870083 AGAACTGGTGTTAGAGAGGCTGG - Intergenic
1028890317 7:95979982-95980004 ACACCTGGTGATAAGGAGCCAGG + Intronic
1029168046 7:98609625-98609647 CCAAGTGGTGTTATAGAGCCTGG + Intergenic
1029237902 7:99137711-99137733 ACAGCTGGAATTACAGAGTGGGG + Intronic
1029583688 7:101455710-101455732 ACAGCTTGGGTGACAGAGCTAGG - Intronic
1031995789 7:128229970-128229992 ACAGCTGGTATAGCAGAGCCTGG + Intergenic
1032855883 7:135833083-135833105 AGTGCTGGGGTTACAGCGCCTGG + Intergenic
1033474170 7:141674811-141674833 CCAGCTCGGGTCACAGAGCCTGG + Intronic
1033760320 7:144430258-144430280 AGAGCTGTTGTTATAGAACCGGG - Intergenic
1033993035 7:147311461-147311483 ACAGCAGGAGTAAGAGAGCCAGG - Intronic
1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG + Intergenic
1035722674 8:1803654-1803676 ACAGCGAGTGTGAGAGAGCCTGG - Intergenic
1037221749 8:16531511-16531533 ATCTCTGGTGTTACAGAGCCAGG + Intronic
1038565482 8:28616796-28616818 ACAGCTGGTGACACAGCACCTGG + Intronic
1039904978 8:41779996-41780018 ACAGCTTTTGCTACAGAGCACGG + Intronic
1039922635 8:41904041-41904063 AAAGCTGGAGTTATAGATCCAGG - Intergenic
1040520778 8:48174301-48174323 ATAGCTGGGGTGACAGGGCCTGG - Intergenic
1041021790 8:53645442-53645464 GCAGCTGAGGTTACATAGCCAGG + Intergenic
1042186138 8:66138031-66138053 ACTGCTCCAGTTACAGAGCCAGG - Intronic
1043933532 8:86117730-86117752 AGGGCTGATGTTACTGAGCCTGG + Intronic
1044970868 8:97618358-97618380 ACAGCTAGTGATACAAACCCAGG + Intergenic
1045388366 8:101691912-101691934 ACAGCAAGAGCTACAGAGCCGGG + Intronic
1046006276 8:108489714-108489736 ACCTCTTGTGTTACAGAGCATGG + Intergenic
1046614622 8:116462521-116462543 AAAGCTTTTGTTACAGTGCCTGG - Intergenic
1047578526 8:126185933-126185955 ACAGCTGACGTTACCGATCCAGG - Intergenic
1048219857 8:132531256-132531278 ATAGCTGATGATACAGAGCAGGG - Intergenic
1049060857 8:140275066-140275088 ACACCTGGTGTGTCAGAGGCTGG - Intronic
1049433980 8:142577794-142577816 CCAGCTGGTGGAACACAGCCAGG - Intergenic
1049688344 8:143948195-143948217 ACAGCTGGTGCTCCCTAGCCAGG + Intronic
1051395959 9:16620990-16621012 TCCGCTGTTGTCACAGAGCCAGG + Intronic
1055022767 9:71687884-71687906 CCAGCTGGGGTGACAGAGCAAGG - Intronic
1056994715 9:91445321-91445343 ACAACTGGCCTCACAGAGCCTGG - Intergenic
1057551477 9:96053941-96053963 ACAGGTGATTTTACAGAGTCGGG + Intergenic
1057759243 9:97859494-97859516 AAAGCTGGGGTGACAGAGCCAGG + Intergenic
1058906035 9:109483387-109483409 ACAGCTGGTGTTAGTGAGAGGGG - Intronic
1060566544 9:124597870-124597892 CCAGCTTGTGTGACAGAGCGAGG - Intronic
1060947565 9:127579151-127579173 CCAGCTGGTGACTCAGAGCCTGG + Intergenic
1061205927 9:129163412-129163434 ATAACTGGTATTACACAGCCAGG - Intergenic
1062721775 9:138048247-138048269 GCAGCAGGAGTGACAGAGCCAGG + Intronic
1187303600 X:18074886-18074908 ACAGCTGGGATTATAAAGCCAGG - Intergenic
1188392624 X:29640045-29640067 ACAGCTGGTGTTACGGAGGTTGG + Intronic
1189226291 X:39416030-39416052 ACAGCTGTTGCGACAGTGCCTGG + Intergenic
1190641735 X:52486859-52486881 ACAGCTGCTGTTGCAGAGCCAGG - Intergenic
1190645937 X:52526006-52526028 ACAGCTGCTGTTGCAGAGCCAGG + Intergenic
1193613375 X:83659205-83659227 GCAGCTGCTGTTAAGGAGCCTGG - Intergenic
1194127695 X:90040445-90040467 ACAGTTGGTGTTATACAGCCTGG + Intergenic
1195341070 X:103906640-103906662 AGAGAGGGTGTTACAAAGCCAGG - Intergenic
1198631578 X:138644797-138644819 AAAGCTGGTGTCACAGGGCAAGG + Intronic