ID: 1130730077

View in Genome Browser
Species Human (GRCh38)
Location 15:86482822-86482844
Sequence TTGGCTGATGAAGCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130730077_1130730079 8 Left 1130730077 15:86482822-86482844 CCAACAAAAGCTTCATCAGCCAA 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1130730079 15:86482853-86482875 TGTCTCATTATGTCAGATGAAGG 0: 1
1: 0
2: 0
3: 11
4: 181
1130730077_1130730080 17 Left 1130730077 15:86482822-86482844 CCAACAAAAGCTTCATCAGCCAA 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1130730080 15:86482862-86482884 ATGTCAGATGAAGGATGACAAGG 0: 1
1: 0
2: 3
3: 19
4: 273
1130730077_1130730081 30 Left 1130730077 15:86482822-86482844 CCAACAAAAGCTTCATCAGCCAA 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1130730081 15:86482875-86482897 GATGACAAGGTTCATAAATTTGG 0: 2
1: 9
2: 25
3: 72
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130730077 Original CRISPR TTGGCTGATGAAGCTTTTGT TGG (reversed) Intronic
907349323 1:53812962-53812984 TTGGCTGATAATTGTTTTGTTGG - Intronic
910821922 1:91360013-91360035 TTTGCTTATGAAGCTTTGTTTGG - Intronic
911680011 1:100704439-100704461 TTGGAAGATAAACCTTTTGTGGG + Intergenic
912886253 1:113478018-113478040 TTAGCTGATGCAGCTTGTGCAGG + Intronic
916153610 1:161821924-161821946 CTCTCTGATGTAGCTTTTGTGGG + Intronic
917139248 1:171818338-171818360 TTGGCTGAAGAAGCATGAGTGGG + Intergenic
917377304 1:174363254-174363276 TTGGCTATTCAAGCTTTTCTGGG + Intronic
917393596 1:174566906-174566928 AAGGCTGATGAAGCTTTTCTGGG - Intronic
923855312 1:237839243-237839265 ATTGCAGATGAAGCTTTGGTGGG + Intergenic
1064245460 10:13664372-13664394 TTGGCTGAGGGAGCTTTACTAGG + Intronic
1064933683 10:20655881-20655903 TTCGCTTATGAAGCTTTGTTTGG + Intergenic
1065303192 10:24343452-24343474 TTGGATGATGAGGTTTTTGGGGG + Intronic
1065333657 10:24631425-24631447 TTAGCTGTTGAAGCATTTGGTGG - Intronic
1065504305 10:26414113-26414135 GTAGCTGAGGTAGCTTTTGTAGG + Intergenic
1065969782 10:30797189-30797211 TTGCTTGATGAAGCATTTGGTGG + Intergenic
1067519909 10:46991672-46991694 TTTGCTTATGAAGCTTTCTTTGG + Intronic
1067642340 10:48060170-48060192 TTTGCTTATGAAGCTTTCTTTGG - Intergenic
1068186432 10:53592263-53592285 TTTGCTTATGAAGCTTATTTTGG + Intergenic
1069368640 10:67720603-67720625 TTCGCTTATGAAGCTTAGGTTGG + Intergenic
1070976725 10:80611254-80611276 TTGGCTCCTAAAGCTTTTGCAGG + Intronic
1071760848 10:88604689-88604711 TTTGATGATGAAGGTTTTGGAGG + Intronic
1072889385 10:99308402-99308424 TTGGTTGATGGAGATTTTGATGG - Intergenic
1073518435 10:104101173-104101195 TTGGCTTATGAGGATTTTTTAGG + Intergenic
1073771999 10:106745003-106745025 TTGGCTAATAAACTTTTTGTTGG - Intronic
1074028443 10:109661484-109661506 TTTGCTTATGAAGCTTAGGTTGG + Intergenic
1074534870 10:114321559-114321581 TAGGCTGAGGAAGGTGTTGTTGG - Intronic
1074805475 10:117046699-117046721 TTGGATGATGTAGCATGTGTAGG - Intronic
1076273482 10:129176514-129176536 TTGCCTGATGAAGCTCTAATAGG - Intergenic
1077669835 11:4147106-4147128 TAGGCTGATGCAGATTTTGCCGG + Intergenic
1078239520 11:9518136-9518158 TTGAGTTATGAATCTTTTGTGGG - Intronic
1078336557 11:10467910-10467932 TTTGCTTATGAAGCTTTGTTTGG - Intronic
1078363390 11:10687528-10687550 ATGACTGATGAAGCTGGTGTTGG - Intronic
1079780423 11:24595382-24595404 TTGGGACATGAAGCTTTTCTAGG + Intronic
1079800547 11:24862291-24862313 TTTGCTTATGAAGCTTATTTTGG - Intronic
1081795254 11:45814309-45814331 TTGGCTGATGATTCTGATGTCGG + Intergenic
1085291762 11:75405327-75405349 TTGGCTGCTCAAGATTTTCTAGG + Intronic
1086301700 11:85433061-85433083 TTTGCTGATGAAGCTTAGTTTGG - Intronic
1087346817 11:96982114-96982136 TTGTCTGATAAAGCTTTCCTTGG + Intergenic
1091002354 11:131920668-131920690 TTGGCTTAGAAAGCTTTTGGGGG + Intronic
1095334005 12:41005178-41005200 TTGGCTTATGAAGCTTAGTTTGG + Intronic
1095510139 12:42942707-42942729 TTTGCTTATGAAGCTTATTTTGG + Intergenic
1097749707 12:63338206-63338228 TTGGCTATTGAAGCTTGTGCAGG - Intergenic
1101188999 12:102312011-102312033 TTCGCTTATGAAGCTTATTTTGG + Intergenic
1101629890 12:106483022-106483044 ATGGCTGAAGAAGCTTTAGTGGG - Intronic
1101946537 12:109141496-109141518 CTGGCTGGTGAAGTTTTGGTTGG - Intronic
1103068700 12:117922215-117922237 TTGGCTGATGAAAATTTTGTAGG - Intronic
1104697504 12:130874527-130874549 TGGGCTGAAGAAACATTTGTGGG - Exonic
1105912114 13:24878805-24878827 ATGGCTGGTGAAGCATTTCTAGG - Intronic
1106266818 13:28118140-28118162 TTGCCTCATGAACCTTTTATGGG - Intergenic
1108434140 13:50385207-50385229 TTGGCTAAAGAAGGTTTTGTAGG + Intronic
1109867161 13:68280375-68280397 TTGTTTTATGATGCTTTTGTAGG + Intergenic
1111211856 13:85089890-85089912 TTGGTTCATGAAGCTTTAGGGGG - Intergenic
1112782843 13:102920534-102920556 TTGGCTGATGAGGCTTCTTTTGG - Intergenic
1114084559 14:19229855-19229877 TTTGCTGATGACGCCCTTGTAGG - Intergenic
1115451818 14:33556800-33556822 TGGACTGATGAAGCTGGTGTGGG - Intronic
1116090185 14:40294733-40294755 TTTGCTTATGAAGCTTAGGTTGG + Intergenic
1116336920 14:43667931-43667953 TTTGCTGATGAAGCTTATTTTGG - Intergenic
1118448617 14:65876047-65876069 TTTGCTTATGAAGCTTTATTTGG + Intergenic
1118458199 14:65963900-65963922 TTGGATGATCAAGTTTCTGTAGG + Intronic
1119124789 14:72115628-72115650 GGGGCTGTTGAGGCTTTTGTGGG - Intronic
1120028696 14:79615367-79615389 TTGGCTGATGAAGGTTGACTAGG + Intronic
1120825709 14:88953076-88953098 CTGGCCGATGAAGCCTTTGTTGG + Intergenic
1120945483 14:89991376-89991398 TTTGCAGTTGAAGCTTTTGCAGG + Intronic
1122013036 14:98769470-98769492 CTGGCAGATGAAGCCTCTGTAGG - Intergenic
1122368245 14:101211348-101211370 TTGGCTTGTGATGTTTTTGTCGG + Intergenic
1123131919 14:105994237-105994259 ATGGCAGAGGAAGCTTTGGTGGG - Intergenic
1128895676 15:71371527-71371549 TTGGCTTATGAAGCTTAGTTTGG + Intronic
1129559928 15:76555131-76555153 TTGGCTTATGAAGCTTAGTTTGG - Intronic
1130442120 15:83964915-83964937 TTCGCTTATGAAGCTTAGGTTGG - Intronic
1130730077 15:86482822-86482844 TTGGCTGATGAAGCTTTTGTTGG - Intronic
1131885626 15:96908876-96908898 TTGTCTGAAGAAGATTGTGTAGG - Intergenic
1132271627 15:100531391-100531413 TTTGCTGGTGAAGACTTTGTGGG + Intronic
1132271636 15:100531441-100531463 TTTGCTGGTGAAGACTTTGTGGG + Intronic
1133626583 16:7575561-7575583 TTGCCTCATTTAGCTTTTGTTGG - Intronic
1140774157 16:78234812-78234834 TTGGCTGATGAGACCTGTGTGGG - Intronic
1143469154 17:7160913-7160935 TTGGCTGAGCAAGCTTCTATTGG - Intergenic
1144414229 17:15031292-15031314 GTGGCTGATGAAGCTTGTTGGGG - Intergenic
1146067520 17:29648176-29648198 TTGTCTCATGAAGCTTGGGTTGG + Exonic
1148682404 17:49482214-49482236 GTGGCTGTTTAAGCTGTTGTTGG + Intergenic
1152590104 17:81207439-81207461 GTGACTGATGAAGCTTCTGATGG - Intronic
1153111948 18:1601455-1601477 TTGGCAGGTGAAGCTTGTGTGGG + Intergenic
1153332692 18:3890049-3890071 TTGGATGAGTAAGCTTTTGTGGG - Intronic
1154375686 18:13807852-13807874 TTAGGTGATGAAGCTTTTTTAGG - Intergenic
1154490183 18:14916118-14916140 TTGGCTGATGGTGCTGCTGTGGG + Intergenic
1161057147 19:2196282-2196304 CTGGCAGATGAACCTTTTGGAGG + Intronic
1162435474 19:10655102-10655124 ATTGCTGAGGAAGCCTTTGTGGG + Intronic
1163264982 19:16215069-16215091 TTTGCTGATGAAGCTTAGGTTGG + Intronic
1163473755 19:17512828-17512850 TGAGCTGATGATGGTTTTGTGGG + Intronic
1163914427 19:20227740-20227762 TTCACTGATGAAGCTTAGGTTGG + Intergenic
1164468282 19:28506487-28506509 GTAGCTGAAGAAGCTTTGGTCGG - Intergenic
1165161145 19:33817178-33817200 TGGGCTGATGTAGCTGTTGTAGG + Intergenic
926399895 2:12486673-12486695 TTTGCTGCTGAAGCTTTTCGTGG - Intergenic
927014785 2:18947842-18947864 TTGGCGGCTGAATATTTTGTAGG - Intergenic
928488481 2:31756249-31756271 TTTGCTTATGAAGCTTATTTTGG - Intergenic
929942381 2:46344411-46344433 TGTGTTGATGATGCTTTTGTTGG + Intronic
933936910 2:87213459-87213481 TTGGCTGGGGAAGCTTTTCTTGG + Intergenic
935502303 2:103856539-103856561 ATGTCTCATGAGGCTTTTGTGGG + Intergenic
935983042 2:108645386-108645408 TTCGCTTATGAAGCTTTGTTTGG - Intronic
936356233 2:111752366-111752388 TTGGCTGGGGAAGCTTTTCTTGG - Intergenic
937126660 2:119478922-119478944 TTGTCTGATGCTGCTTTTCTTGG - Intronic
937545858 2:123019794-123019816 TTGGCTGATTGAACTTCTGTAGG + Intergenic
937603295 2:123766870-123766892 CTGGCTGAAGCAGCTTTTGTAGG + Intergenic
938492029 2:131766255-131766277 TTTGCTGATGACGCCCTTGTAGG + Intronic
938495538 2:131796088-131796110 TTTGCTGATGACGCCCTTGTAGG - Intronic
938549210 2:132364551-132364573 TAGTCTGATGAAACTATTGTAGG - Intergenic
939942255 2:148364237-148364259 TTCGCTTATGAAGCTTTGTTTGG - Intronic
942257994 2:174125960-174125982 TTGGCTGTTAAATCTTTTGTGGG - Intronic
942523758 2:176831274-176831296 TAGGCTGATGCAGCATTTGTTGG + Intergenic
943956869 2:194202876-194202898 TTGGATGATAGACCTTTTGTGGG + Intergenic
943991588 2:194700374-194700396 CTGGCTGATGAAAATTTTTTAGG + Intergenic
945775767 2:214104362-214104384 TGGTCTGATTCAGCTTTTGTTGG + Intronic
948740230 2:240041729-240041751 TGAGCTGAAGAAGCTTTTCTTGG + Intergenic
1173526578 20:43737503-43737525 CTGGCTGTTTAAGCATTTGTGGG - Intergenic
1174222997 20:48972245-48972267 TTGGCTGCTGAAGACTTTGGAGG + Intronic
1175031755 20:55961726-55961748 TTGGCTAATGAAATGTTTGTAGG - Intergenic
1175139766 20:56852324-56852346 TTGACAGATGATGCTTTTTTAGG + Intergenic
1175205069 20:57305087-57305109 TTTGGAGATGAAGCTTTTGGGGG + Intergenic
1178193272 21:30311946-30311968 TTGGCTGAGGAACTTTGTGTTGG + Intergenic
1178760899 21:35401806-35401828 TAGGCTGATGAAGGATTGGTGGG - Intronic
1180136137 21:45863233-45863255 TTGGCTGGTGACGCTCTTGCAGG - Intronic
1180226807 21:46398383-46398405 TTGTCTGAGGAAGCTGTAGTAGG + Intronic
1180293411 22:10863346-10863368 TTTGCTGATGACGCCCTTGTAGG + Intergenic
1180456932 22:15517737-15517759 TTTGCTGATGACGCCCTTGTAGG + Intergenic
1180496217 22:15892762-15892784 TTTGCTGATGACGCCCTTGTAGG + Intergenic
1181435231 22:22906582-22906604 CTGGCAGCTGTAGCTTTTGTGGG - Intergenic
949434938 3:4018966-4018988 TTGGTTGATGATTCTTGTGTTGG - Intronic
950516258 3:13467601-13467623 GGGGCTCATGAAGCTTTAGTGGG - Intergenic
951740681 3:25919519-25919541 TTTGCTTATGAAGCTTTGATAGG - Intergenic
954992760 3:54855260-54855282 TAGGCTTATGAAGCTTTAGAGGG - Intronic
955119373 3:56041391-56041413 TCTGCTGATGAAGCTGCTGTAGG + Intronic
955122691 3:56076705-56076727 ATCTCTGATGAAGCTTTTGTGGG - Intronic
957798225 3:85039884-85039906 TTGGCTGCTGAAACTATTGCTGG - Intronic
958519713 3:95168993-95169015 TGGCCTGATGAAACTTTTTTTGG - Intergenic
958862741 3:99465184-99465206 TTGACTGATGAGCCTTTTGAAGG - Intergenic
959291203 3:104476366-104476388 TTTGCTTATGAAGCTTAGGTTGG - Intergenic
959372866 3:105550890-105550912 TTTTCTGAAGAAGCTGTTGTTGG - Intronic
959462868 3:106648775-106648797 TTTGCTTATGAAGCTTATTTTGG - Intergenic
960343258 3:116501100-116501122 TTGGCTATTCAAGCTCTTGTTGG - Intronic
961123894 3:124398726-124398748 GTGGCTGATGGAGCTGCTGTGGG - Exonic
961438146 3:126933330-126933352 ATGGCTCAGGAAGCTTTTGGTGG + Intronic
961988311 3:131160322-131160344 TTCGCTTATGAAGCTTATTTTGG - Intronic
962744773 3:138389276-138389298 TTGAGTGCTGAAGCTTTTGTGGG + Intronic
966269917 3:178092182-178092204 TTGGCTTATGAAGCTTAATTTGG - Intergenic
966276844 3:178183347-178183369 TTGGCTGATGCAGCCATTATTGG - Intergenic
968222138 3:196947382-196947404 TTGTCTGGTGAAGCTTTTCAGGG + Exonic
969644218 4:8417189-8417211 TTGGCTGATGAAGGCATTGAAGG + Intronic
971044908 4:22794800-22794822 CTTGCAGATGAAGCTATTGTGGG + Intergenic
971107632 4:23543926-23543948 TTGGCTTATGAAGCTTAGTTTGG - Intergenic
971916199 4:32872849-32872871 TTGTCAGTTGAAGCATTTGTTGG + Intergenic
974271674 4:59657844-59657866 TTTGCTTATGAAGCTTAGGTTGG - Intergenic
976354995 4:84106662-84106684 TTGGCTAATGAAGCTACTGCAGG + Intergenic
976583255 4:86765304-86765326 TTGGCTAATGAATCCTTTCTAGG + Intronic
976727846 4:88232197-88232219 TTGGCTTAAGAAGCTTTTCAAGG - Intergenic
976992161 4:91380995-91381017 TTCACTGATGAAGCTTATTTTGG + Intronic
977154677 4:93556984-93557006 TTCGCTGATGAAGCTTAGTTTGG - Intronic
978918984 4:114159044-114159066 TTGACATATGAAGTTTTTGTGGG - Intergenic
979965772 4:127075579-127075601 TTCGCTGATGAAGCTTAGTTTGG + Intergenic
983420017 4:167505499-167505521 TTTGCTTATGAAGCTTTGTTTGG + Intergenic
986325788 5:6672759-6672781 TTGGCTTATGGAGAATTTGTTGG + Intergenic
986385235 5:7226852-7226874 TTGGCTGATGGAGCATCAGTAGG - Intergenic
987073468 5:14359386-14359408 GTGGTTGATGGAGCTGTTGTGGG - Exonic
987528009 5:19078928-19078950 TTCGCTTATGAAGCTTTATTTGG + Intergenic
989364985 5:40645616-40645638 TTTCCTGGTGAAGATTTTGTGGG - Intergenic
994551222 5:101237803-101237825 TTGGCTTATGAAGCTTAGTTTGG + Intergenic
994617459 5:102123066-102123088 TTGGATGAATAAGTTTTTGTAGG + Intergenic
994734609 5:103537084-103537106 TTGGATGATAAAGATTTTTTTGG + Intergenic
997285740 5:132676991-132677013 CTGGCTGATGAAGGGTTTCTTGG + Intronic
997671308 5:135675673-135675695 TTGGCTATTTAAGCTTTTATCGG + Intergenic
998785357 5:145702809-145702831 TTGGCTGCTGAAGTTTTATTAGG - Intronic
998789077 5:145745909-145745931 TTTGCTGATGAAGCTTAGTTTGG - Intronic
1004395909 6:15246192-15246214 TTCGCTGATGTAGTTTTTGGAGG + Intergenic
1006742279 6:36317711-36317733 TTGGCAGATGAAGCCTTTGAAGG + Intronic
1007936982 6:45741175-45741197 TTGGCTCATGTTGCCTTTGTAGG + Intergenic
1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG + Intergenic
1012151537 6:95760142-95760164 TTCGCTTATGAAGCTTATTTTGG - Intergenic
1013436815 6:110117906-110117928 TTGGCTTATGAAGCTTAGTTTGG - Intronic
1014767605 6:125424640-125424662 TTGGCTCATAAAGCTTATTTTGG + Intergenic
1018578451 6:165284718-165284740 TTTGCTTATGAAGCTTATTTTGG - Intronic
1020519388 7:9167611-9167633 TTTGCTTATGAAGCTTAAGTTGG + Intergenic
1021056689 7:16057068-16057090 TTGGCTTACGAATCTTTGGTGGG - Intergenic
1021170353 7:17391834-17391856 TTGGCTGATGGAGTTTTTATGGG - Intergenic
1022961635 7:35431854-35431876 TTTGCTTATGAAGCTTAGGTTGG - Intergenic
1023726158 7:43144310-43144332 TTGGCTGAGGTAGTGTTTGTTGG + Intronic
1025772924 7:64529735-64529757 AAGGCTGAGGAAGCTTTTCTCGG - Intronic
1031242910 7:119269083-119269105 TTTGCTGATGAAGCTTAGTTTGG + Intergenic
1037024011 8:14009706-14009728 CTAGCAGATGAAGCTTTTGGAGG + Intergenic
1039832493 8:41226320-41226342 TTGGCTATTGAAGCTTGTGATGG - Intergenic
1040084375 8:43324694-43324716 TTTGCTTATGAAGCTTATTTTGG + Intergenic
1040738314 8:50539085-50539107 TTGCCTGTTGAAGCATTTTTAGG + Intronic
1040748807 8:50680403-50680425 ATAGCTGATGAAGCTGTAGTTGG + Intronic
1041309383 8:56499079-56499101 TTCTCTGTTGAAGCTTTTCTGGG + Intergenic
1041427304 8:57737185-57737207 TTAGCTTATGAAGCTTATTTTGG + Intergenic
1041476354 8:58271639-58271661 TTGGGTGGTGAAGCTTCTGTAGG + Intergenic
1041534842 8:58914635-58914657 TTGGTTGAACAAGTTTTTGTGGG - Intronic
1044346416 8:91109577-91109599 TTTCCTTATGAAGCTTTTGATGG + Intronic
1045625683 8:104046321-104046343 TTAGCAGATGGAGCTTTTGGTGG - Intronic
1048250486 8:132862899-132862921 TTGGCTCAAGAGGCTTTTCTGGG + Intergenic
1048346511 8:133579707-133579729 TTGCCTAATGACGCTTTTCTTGG + Intergenic
1051447210 9:17153404-17153426 TTCGCTTATGAAGCTTATTTTGG + Intronic
1052206720 9:25850451-25850473 TTGGCTGAAGAAACTTTGGGAGG - Intergenic
1052470671 9:28890862-28890884 TTAGCTGCTGAAGATTTTCTAGG - Intergenic
1055304127 9:74910892-74910914 TAGGCTGCAGAAGTTTTTGTAGG - Intergenic
1055781259 9:79823948-79823970 TTGACTGCTTAAGCTTTTCTTGG - Intergenic
1056481177 9:87007907-87007929 TTGGCTGATAAGGCATTTGTAGG + Intergenic
1058110219 9:101024304-101024326 TTGGGTGATGAGGAGTTTGTGGG - Intergenic
1059386520 9:113969082-113969104 TTGGCTGATGTAGGTGTTTTGGG + Intronic
1061144710 9:128790884-128790906 TTGTCTGAGGGAGCTTTTCTGGG + Intronic
1061597603 9:131642224-131642246 TTGCCCCAAGAAGCTTTTGTTGG - Intronic
1186963237 X:14759901-14759923 TTGGCTTATGAAGCTTAGTTTGG - Intergenic
1189861833 X:45280528-45280550 TTTGCTTATGAAGCTTATTTTGG + Intergenic
1191039319 X:56062432-56062454 TTGGCTTATGAAGCTTAGTTTGG + Intergenic
1192067440 X:67901673-67901695 TTTGCTGAAGAAGCTTTGTTTGG + Intergenic
1192293033 X:69817112-69817134 TTCGCTTATGAAGCTTATTTTGG - Intronic
1192406606 X:70892126-70892148 TTTGCTTATGAAGCTTATTTTGG - Intronic
1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG + Intergenic
1193364982 X:80621660-80621682 TTTGCTTATGAAGCTTATTTTGG + Intergenic
1193551685 X:82900951-82900973 TTTGCTGATGAAGCTTAGTTTGG - Intergenic
1193750790 X:85340690-85340712 TTGGCTGATGAAACTGTTGAAGG + Intronic
1193768345 X:85559666-85559688 TTGGCTTATGAAGCTTAGTTTGG + Intergenic
1194355827 X:92882579-92882601 TTGGCTGTTCAAGCTCTTTTTGG - Intergenic
1194541110 X:95173551-95173573 ATGGCTGTTGAAGGTTTTGAAGG + Intergenic
1195846140 X:109230677-109230699 TTCACTTATGAAGCTTTTTTTGG - Intergenic
1197071090 X:122298831-122298853 TTGGCTTATGAAGCTTAGTTTGG + Intergenic
1197090092 X:122525874-122525896 TTTGCTTATGAAGCTTATTTTGG - Intergenic
1197118180 X:122858504-122858526 TTGGCTGATGATGATGTTGATGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1198577753 X:138028380-138028402 TTTGCTTATGAAGCTTATATTGG - Intergenic
1198638982 X:138734929-138734951 TTGGCTGAAGTAGTTCTTGTAGG + Intronic
1199506309 X:148565352-148565374 TTTGCTGCTGATGCTTTTGGGGG - Intronic
1200664174 Y:5999560-5999582 TTGGCTGTTCAAGCTCTTTTTGG - Intergenic
1201932105 Y:19361449-19361471 TTGGCTTATGAAGCTTAGTTTGG - Intergenic