ID: 1130730996

View in Genome Browser
Species Human (GRCh38)
Location 15:86492070-86492092
Sequence AAGTGCTCCTAGAATAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130730996 Original CRISPR AAGTGCTCCTAGAATAGTGA GGG Intronic
900844001 1:5081667-5081689 AAGTGCTCATGGAACAGAGAAGG + Intergenic
902838525 1:19061265-19061287 AAGTGAGCCTGGCATAGTGAGGG + Intergenic
905223538 1:36465084-36465106 AAATGCTCTCAGAAAAGTGAGGG - Intergenic
906284353 1:44576900-44576922 AAGTGAGCCTAGAGTAGAGAAGG - Intronic
907890744 1:58634317-58634339 AAGACTTCCTAGAATTGTGACGG - Intergenic
911199402 1:95029328-95029350 AAGTGCTCCAAGAAGAGGCAAGG + Intronic
912955091 1:114149845-114149867 CAGTGCTCCTAGAAGAAAGAAGG + Intronic
915743167 1:158135313-158135335 AAGTGTTCCTACACTAGTGAAGG - Intergenic
918428406 1:184434095-184434117 AAGTGCTCATGGTCTAGTGAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
923069278 1:230547979-230548001 AAATGTTCCCAGAATTGTGAAGG + Intergenic
1064652658 10:17525006-17525028 AAGTGCTTCTAGAAAACTCAAGG + Intergenic
1065864183 10:29899288-29899310 AGCTGCTCCCAGAATAGCGAAGG + Intergenic
1066802923 10:39209939-39209961 AAGTGCTGCTCGAACAGTCACGG + Intergenic
1071168397 10:82833707-82833729 TAGTGCTTCAAGAATTGTGAAGG - Intronic
1077733599 11:4764406-4764428 AAGTGTCCCCAGAATAGAGATGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079355292 11:19725535-19725557 AAGTACTCCTAAACTAGAGACGG + Intronic
1080950224 11:37023770-37023792 AACAGCTCACAGAATAGTGATGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084063930 11:66692736-66692758 GAGTGCTGCAAGAAGAGTGAGGG + Exonic
1086055683 11:82643376-82643398 AAGACCTCATAAAATAGTGAAGG - Intergenic
1086747050 11:90441833-90441855 AGGTGCTACTATAATAGTGTGGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087897500 11:103602982-103603004 AAGTAATCTTAGAAGAGTGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1090563513 11:127960060-127960082 AAGTGCTCTTAACATAGTAAAGG - Intergenic
1092182709 12:6457193-6457215 AAGTGATCCCAAAATGGTGATGG + Intronic
1093395035 12:18670746-18670768 AAGTGCACCTAAAATAGTTCAGG - Intergenic
1093634185 12:21444930-21444952 AAGTGAGTCTAGAATACTGATGG + Intronic
1093866370 12:24231908-24231930 AACTGTTCCTAGAACAGTGCTGG + Intergenic
1095168192 12:39000089-39000111 AAGAGCTCATAGACTAGTGAAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097458959 12:59835952-59835974 ATGTTCACCTACAATAGTGAGGG + Intergenic
1098723815 12:73936534-73936556 AAGTATTCTTAGAATATTGATGG - Intergenic
1100126507 12:91433412-91433434 TAGGGCTCCTATAATAGTGCTGG - Intergenic
1100165112 12:91908090-91908112 ATTTGCTCCTAGAATATGGATGG + Intergenic
1100503654 12:95198379-95198401 AAGAGCTCCTAGCATAATGCTGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1105336448 13:19474604-19474626 GGGTGCTTCTAGCATAGTGATGG + Intronic
1105766707 13:23567015-23567037 AAGTGGTCCCAGCATTGTGAAGG + Intergenic
1107774112 13:43820063-43820085 AAGTGCATCTATAAAAGTGAAGG + Intergenic
1109157788 13:58932654-58932676 AAGTTCTTCTAGAAAAGTTAAGG - Intergenic
1111044954 13:82802923-82802945 AAGTGCTCTAAGAACAGGGAGGG + Intergenic
1112843672 13:103611158-103611180 TATGGCTCCTAGAATAGTGCGGG + Intergenic
1114067617 14:19077663-19077685 AAGTGCTGAAAGAATAGAGATGG - Intergenic
1114094640 14:19322363-19322385 AAGTGCTGAAAGAATAGAGATGG + Intergenic
1116650616 14:47587028-47587050 ATGTGCTCCTACAATAATGAAGG + Intronic
1117729256 14:58705131-58705153 AAGTGTCCTTAGAAGAGTGAAGG + Intergenic
1118481606 14:66173140-66173162 AAGTGTTATTAAAATAGTGAGGG + Intergenic
1118678194 14:68211414-68211436 AAGAGGTGCTACAATAGTGAAGG - Intronic
1119251286 14:73157051-73157073 AAGTGGTACTAGAATACTGAGGG - Intronic
1119381149 14:74229516-74229538 AAGTGCTCCGAAGATGGTGAAGG - Intergenic
1120186969 14:81403481-81403503 AACGGCTGCTAGAATATTGAGGG + Intronic
1125392523 15:39209762-39209784 AAGTACTGCGAGCATAGTGATGG - Intergenic
1126890575 15:53200040-53200062 AAGTGCTCCAAGAATAATAGAGG + Intergenic
1130730996 15:86492070-86492092 AAGTGCTCCTAGAATAGTGAGGG + Intronic
1135830003 16:25764639-25764661 GACTGCCCCTAGAATAGGGATGG + Intronic
1136140041 16:28282529-28282551 AGGAGCTCCCAGACTAGTGAGGG - Intergenic
1136362827 16:29792037-29792059 AAGTCCTCCCAGAATACTCAAGG - Intronic
1136574245 16:31113854-31113876 AAGTGCTCCCAGAACAGAGTAGG + Intergenic
1140753498 16:78046920-78046942 AAGTGCTTCTAAAATGATGAAGG - Intronic
1144194651 17:12878690-12878712 AAGTGCTTCAGGAATAGTGAAGG + Intronic
1145881473 17:28355942-28355964 AAAAGCTCCTAGGATACTGAGGG + Intronic
1147048612 17:37773583-37773605 AAGTGCTCTCTAAATAGTGAAGG - Intergenic
1148256595 17:46138546-46138568 AAGTCATCCAAGAATACTGAAGG + Intronic
1150997704 17:70338153-70338175 AAGTGCTTGAAGCATAGTGATGG + Intergenic
1151114358 17:71717154-71717176 CAGTGCTCCAATAATAATGAAGG + Intergenic
1152292909 17:79450638-79450660 AGGTGCTCCTGGAATTATGATGG - Intronic
1153060725 18:992224-992246 AAGTGCCCCTAGAAAAATTAGGG - Intergenic
1153694290 18:7624859-7624881 CAGAGCTCCTAGAACAGTGCTGG + Intronic
1154272665 18:12933333-12933355 ATGTGCTGCTAGAATGGAGAAGG - Intergenic
1155014546 18:21819656-21819678 AATTGCACCTAAAATAGTAAGGG - Intronic
1159349140 18:67249192-67249214 CATTGCTCCTAGAATAACGACGG - Intergenic
1159709243 18:71734011-71734033 CAGTGCTCCTGGAATACAGATGG + Intronic
1160170665 18:76550529-76550551 AAGTGCTCGGAGAATAACGATGG - Intergenic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
926261048 2:11262097-11262119 AGGTACTCATAGACTAGTGACGG - Intronic
927926677 2:27018465-27018487 AAGTGCCACAAGAATAGGGAAGG - Intronic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
931095687 2:58938234-58938256 AAGTTCTCTTAGAATATTGTGGG - Intergenic
938485258 2:131700267-131700289 AAGTGCTGAAAGAATAGAGATGG - Intergenic
942142650 2:172993436-172993458 ATCTGTTCCTAGAATAGAGAAGG - Intronic
943898152 2:193394552-193394574 AAATGCATCTACAATAGTGAAGG - Intergenic
944620803 2:201514152-201514174 AAATTCTTCTAGAATACTGAAGG + Intronic
1170165183 20:13354654-13354676 AAGTGCGCCAAGAAAAGTGAAGG + Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173141761 20:40490942-40490964 AAATGCTCCTGGAACACTGATGG + Intergenic
1177029001 21:15958499-15958521 AAATGCTGCTATAATATTGAAGG - Intergenic
1177218442 21:18159449-18159471 AAGTTCTCCTATAAAACTGAGGG - Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1178779955 21:35593231-35593253 GAGTGCTCCTAGAAAGGGGAAGG - Intronic
1179435358 21:41358807-41358829 AAGAGGTCCTAGAGTAGTGTGGG + Intergenic
1179477482 21:41657014-41657036 TAGTGCTCCCAGAAGAGAGATGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1180486092 22:15800233-15800255 AAGTGCTGAAAGAATAGAGATGG - Intergenic
1181895536 22:26104441-26104463 TGGTGATCCTATAATAGTGATGG + Intergenic
1182638047 22:31744669-31744691 AAGTGCTGATTGAATGGTGAGGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952989450 3:38818918-38818940 AAGTGGTCCAAGAATAAGGAGGG - Intergenic
954542535 3:51403673-51403695 TTGGGCTCCTAGAATATTGAAGG - Intronic
954984904 3:54781470-54781492 AAGTGTCCCTAGAACACTGATGG - Intronic
955340729 3:58123222-58123244 GAGTGCTCCGACAATGGTGATGG + Exonic
955415545 3:58687805-58687827 AAGTGCTCTTTTAATAGTTATGG - Intergenic
956931082 3:74043635-74043657 AAGTGCTCCTAGAAGACTGCTGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959031460 3:101304096-101304118 AAATGCTCCTACAATAGTCCAGG + Intronic
960432180 3:117582504-117582526 AAGTCTTGCTAGAATTGTGAGGG - Intergenic
963095873 3:141539467-141539489 AAGTCCCCTTAAAATAGTGAGGG + Intronic
965508359 3:169540953-169540975 AAGGGCTCCCAGTTTAGTGATGG - Intronic
965969174 3:174532571-174532593 GGGTGCTTATAGAATAGTGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
969190728 4:5516632-5516654 AAGTGCAGCAAGAATAGTGATGG + Intergenic
969685064 4:8666908-8666930 AAGTGGTCCTAGGATACTGGTGG + Intergenic
970428756 4:15969162-15969184 GAGTCATCCTTGAATAGTGATGG + Exonic
971706743 4:30054180-30054202 AAGTGATCCTACAATTGTTAAGG + Intergenic
972618391 4:40722451-40722473 CTGTGCTCCTGGAACAGTGAAGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973169246 4:47118978-47119000 AAGTGTTACTAGAAAAATGAAGG - Intronic
977239881 4:94555413-94555435 AGATGCTCCTAGACTAATGATGG - Intronic
977982699 4:103344028-103344050 AAGTGCTCGATGAGTAGTGAGGG - Intergenic
983235213 4:165171427-165171449 AAGGGCACATAGAATAGTGAGGG + Intronic
983829718 4:172310739-172310761 AAGTGATACTAGACTAGGGAAGG + Intronic
987344717 5:16968872-16968894 AAGGGCTACTAGAATAATAATGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992386617 5:76290758-76290780 TGGTGCTCTGAGAATAGTGATGG + Intronic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
998681276 5:144470356-144470378 CAGTGCTCCTAGAAAAGATATGG + Intronic
1002392085 5:178922142-178922164 GAGTTCTCCAAGAAGAGTGATGG - Intronic
1008364685 6:50663867-50663889 TACTGCACCTAGAATAGTTATGG + Intergenic
1008874516 6:56311297-56311319 ATGTGTTCCTAGTATAATGAGGG + Intronic
1009790196 6:68392165-68392187 AAGTGGTCCTTGAACAGTGAGGG + Intergenic
1009967224 6:70590445-70590467 AGGTGTTCCCAGAATAGTCATGG + Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011880189 6:92014752-92014774 AAGTCTTCCTAGAAAACTGATGG - Intergenic
1013221136 6:108078351-108078373 AAGTGCTCAAAGAATAATGTTGG + Intronic
1013635409 6:112024647-112024669 AAGTGTGCTTAGAATATTGAAGG - Intergenic
1013837982 6:114355424-114355446 AAATGCACATAGAATTGTGAAGG - Intergenic
1015734495 6:136384060-136384082 AAGGGCTTCTAAAATAGTGGAGG + Intronic
1016512407 6:144858419-144858441 GAATGCTCCTTGAATAGTTATGG + Intergenic
1016902840 6:149118846-149118868 AAGTTCTCCCAGAAAAGTGTGGG + Intergenic
1020439890 7:8206170-8206192 AAGTTCTCCTAGAACAGTGGAGG + Intronic
1022738396 7:33098080-33098102 AAGTTCTCTTAGAATATTAATGG + Intronic
1027461853 7:78464142-78464164 AAATGCTCCGAGGATAATGATGG - Intronic
1027870138 7:83696222-83696244 AAGTGCTATTAGTACAGTGAGGG + Intergenic
1028927562 7:96375740-96375762 AAGTTACACTAGAATAGTGATGG - Intergenic
1029222476 7:99001266-99001288 AGGTGCTCTTTGAAAAGTGAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1032509758 7:132463353-132463375 ATGTGCTCTAAGAATACTGAGGG - Intronic
1032664044 7:134017141-134017163 AGGTGCCCCTAGAATTGGGAAGG - Intronic
1033986316 7:147229930-147229952 AAATTCTGCTAAAATAGTGAGGG + Intronic
1037342904 8:17866171-17866193 AACTGGTCTCAGAATAGTGAAGG - Intronic
1038119873 8:24601154-24601176 AAGTGCTCCTAGAGTAGAGTGGG - Intergenic
1038916312 8:32027480-32027502 AAATCCTCCTAGATTAGGGAGGG - Intronic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1042034920 8:64522423-64522445 AAGAGCATCTAGAATAATGAAGG + Intergenic
1044069483 8:87739794-87739816 AAGTGTGTCTAGAATAATGAGGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1054888744 9:70229095-70229117 AAATGCTCACAGATTAGTGAGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056768480 9:89459921-89459943 AAGTGCTCCTAGAAAACAGCAGG + Intronic
1059947886 9:119430663-119430685 AACTCCTCCAAGAATAGAGAAGG + Intergenic
1060460017 9:123843114-123843136 AAGTTCTCCAAGAAGAATGATGG - Intronic
1061193933 9:129097305-129097327 TGGTGCTCCTAGAGTGGTGAGGG + Exonic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193638552 X:83983674-83983696 AAGTGTTCCTAGCATAGTCAAGG - Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1195771651 X:108357835-108357857 ATGTTGTCCTAGAATAGGGATGG + Intronic
1198149559 X:133895056-133895078 AAGTGTTCATAGTATAGTGAAGG + Intronic