ID: 1130732675

View in Genome Browser
Species Human (GRCh38)
Location 15:86515183-86515205
Sequence CTGAATAATACCTCTTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130732675 Original CRISPR CTGAATAATACCTCTTGTCT AGG Intronic
904852559 1:33469748-33469770 CTGAAAAATACCTTTTCCCTGGG + Intergenic
908714649 1:67056169-67056191 CAGAACATTACCTCTTCTCTGGG + Intergenic
909254798 1:73406491-73406513 CCGAATAATACCTTTTTCCTTGG + Intergenic
909832150 1:80205996-80206018 TTGACTAATACCTCTGGTATAGG + Intergenic
910184015 1:84515986-84516008 CTAAATAATTCATCTTTTCTTGG - Intergenic
911937167 1:103992117-103992139 GTGAGTAATACCTTCTGTCTGGG - Intergenic
912625468 1:111202445-111202467 CTGAATAATAATTCCTTTCTAGG - Intronic
914762715 1:150612055-150612077 CTGAAGAATTCCTCGTGCCTCGG + Intronic
918273894 1:182932125-182932147 CTGAATAACATTCCTTGTCTGGG + Intronic
918596057 1:186294502-186294524 CTAAATAATCCCCCTTTTCTGGG - Intergenic
918862866 1:189855606-189855628 CTGAATAATTTATCATGTCTTGG + Intergenic
919270261 1:195332675-195332697 GTGTATAATACCTCTTATCGGGG + Intergenic
921061908 1:211592317-211592339 CTGAATAATACCCCTTGACTGGG - Intergenic
923102386 1:230826828-230826850 CTGGATAGCACCTCTAGTCTTGG - Intergenic
923778459 1:237000287-237000309 CTGAAGAAATCCTCTTGCCTTGG - Intergenic
1063302034 10:4858625-4858647 CTGAAATATTCCTCTCGTCTTGG - Intergenic
1063849030 10:10163427-10163449 CTGATTAATTCCTCTTTTCATGG - Intergenic
1064961836 10:20973735-20973757 CTAAATCAAACCTCTTGACTTGG - Intronic
1066593524 10:37022633-37022655 CTGATTTATACCCCTTGTCAAGG + Intergenic
1066660531 10:37735122-37735144 CAGAAGAATATCTCTTGGCTGGG - Intergenic
1068636947 10:59358652-59358674 CTCAACAATACCTATTGTTTGGG + Intronic
1071183081 10:83009404-83009426 CTGCATATTGCCTCTTGCCTAGG - Intergenic
1071735094 10:88289764-88289786 CTGAATAATACTTTTTGTGTAGG - Intronic
1073551145 10:104402847-104402869 TTGAAAAATACCTCTTCTCCTGG - Intronic
1075889693 10:125936770-125936792 ATGAATAGTACCTCTAGGCTGGG + Intronic
1078493169 11:11788135-11788157 CTGAAAAATACCTCCTGCCAAGG - Intergenic
1078588777 11:12619535-12619557 CTGAATAATACATCTTGCTTTGG + Intergenic
1079780648 11:24598644-24598666 ATTAATAATATCTCTTTTCTCGG - Intronic
1080039577 11:27745156-27745178 GTAAATACTACCTCTTTTCTGGG - Intergenic
1081179171 11:39966246-39966268 ATGGATAATTCCTCTTCTCTAGG + Intergenic
1082058769 11:47842754-47842776 CTGAAGAAATCCTCCTGTCTTGG - Intronic
1085894778 11:80625728-80625750 CTGATTTATACCCCTTGTCAAGG - Intergenic
1088171762 11:107005890-107005912 CTAGATAATACCTTTTGTCATGG - Intronic
1093357386 12:18183379-18183401 CTGCATTTTACCTCTTGTGTGGG - Intronic
1095691110 12:45089789-45089811 CTGCATAATAGTTCTTGTTTTGG + Intergenic
1097647557 12:62254911-62254933 CTGAATAATTCAGCTTCTCTTGG + Intronic
1098102637 12:67034771-67034793 CTGAAAAATTCCTGTTGCCTAGG - Intergenic
1099170792 12:79361385-79361407 ATGAATAAAACCTGATGTCTAGG + Intronic
1100595976 12:96072512-96072534 CTGAATAATATGTCTTCTTTAGG - Intergenic
1101428876 12:104610234-104610256 CTAAATAAGACCTCATCTCTGGG + Intronic
1106780989 13:33058716-33058738 CTGAATAAAAGCTGTTGTTTTGG + Intronic
1107109040 13:36675538-36675560 CTGAATTATACAACTAGTCTGGG + Intronic
1107856021 13:44616263-44616285 CTGAAGCATTCCTCTTGCCTCGG + Intergenic
1110193454 13:72757874-72757896 CTGAAAAATTCCTATTGCCTGGG + Exonic
1113368297 13:109698987-109699009 CTGAAAAATTACTCTTTTCTGGG - Intergenic
1121538124 14:94705338-94705360 CTTAATAATACCAGTTGTCAAGG - Intergenic
1125171179 15:36768308-36768330 CTCAATCAGACCTCTTCTCTGGG + Intronic
1126170679 15:45692943-45692965 CTGTTTAATACCTATTGTCCTGG + Intergenic
1129788028 15:78322166-78322188 CTGAATCAGGCCTCTTGTCTTGG + Intergenic
1130732675 15:86515183-86515205 CTGAATAATACCTCTTGTCTAGG + Intronic
1134891859 16:17847983-17848005 CTGAATAAGGCCTTTTTTCTTGG + Intergenic
1135127376 16:19822458-19822480 CTGAATAATATCTATCGTATAGG - Intronic
1135672620 16:24388160-24388182 CTTAAAAAATCCTCTTGTCTGGG - Intergenic
1136037780 16:27553579-27553601 CTGAAGAGATCCTCTTGTCTTGG - Intronic
1136747074 16:32600145-32600167 CAGAATAATACTCTTTGTCTGGG + Intergenic
1137834627 16:51579567-51579589 CTCCATTATTCCTCTTGTCTTGG - Intergenic
1139902042 16:70335740-70335762 CTGATTAATAACTGTTGGCTGGG - Intronic
1141318517 16:82984279-82984301 CTGAATGATACTTCAAGTCTGGG - Intronic
1142674558 17:1505691-1505713 TTGAGTTCTACCTCTTGTCTTGG + Intronic
1149333219 17:55607741-55607763 GTGAATATTTCCTCTTGGCTTGG + Intergenic
1150430530 17:65112136-65112158 CAGAATAAGAGCTATTGTCTAGG + Intergenic
1157976765 18:52336778-52336800 CTTTATAATACCTTTTGACTAGG + Intergenic
1162227947 19:9240005-9240027 CTGAATATTCCCTCTTGAATAGG + Intergenic
926420110 2:12687556-12687578 CTGAACAGGACCTCTTGCCTTGG + Intergenic
926883230 2:17572091-17572113 CTGAACAATGCCTGTTGTCCTGG + Intronic
927563368 2:24089644-24089666 CTGAATCCAACCTATTGTCTTGG + Intronic
927753890 2:25693436-25693458 CTGAAAAAGCCTTCTTGTCTGGG + Intergenic
930066782 2:47333719-47333741 TTGAATAAAACATCTTGGCTGGG + Intergenic
933454151 2:82500047-82500069 CCGATTTATACCTCTTGTATTGG + Intergenic
934944833 2:98532759-98532781 CTGAAAAATTCCTATTGCCTAGG - Intronic
936745031 2:115565488-115565510 ATGAATATGACCTCTAGTCTTGG - Intronic
937364586 2:121252340-121252362 CTATATAATAGCTCTTGTCTGGG - Intronic
937495855 2:122418449-122418471 CTGATTCATACCTGTTATCTTGG + Intergenic
938579391 2:132632792-132632814 CTGAGTATTACCTCTCTTCTGGG + Intronic
939968185 2:148631375-148631397 CTGTATAATTCCACTTGTATGGG + Intergenic
943483077 2:188446302-188446324 CTGGATAATAGCTATTTTCTGGG + Intronic
943992404 2:194713350-194713372 CTGAAGGCTTCCTCTTGTCTTGG - Intergenic
946938114 2:224742814-224742836 CTGATTAATGCCTTTTTTCTTGG + Intergenic
947168466 2:227286906-227286928 CTTAATAATACCTATGGACTAGG + Intronic
1168855257 20:1003319-1003341 CTGAGTAATTCCACTTTTCTGGG + Intergenic
1169529092 20:6465111-6465133 CTCAATAATACCCCTTATATTGG + Intergenic
1171077388 20:22142497-22142519 CTGAATAATAACCCTTGTGATGG + Intergenic
1177599752 21:23295356-23295378 CTGAGTGATACCTTTTCTCTAGG - Intergenic
1178351776 21:31876737-31876759 CTCATTAATTCCTCTTTTCTTGG + Intronic
1178750172 21:35295266-35295288 CAGAATAGTACTTCTTGTCTGGG + Intronic
1179038696 21:37782816-37782838 CTGGATTATGCCTGTTGTCTTGG + Intronic
1179610322 21:42545946-42545968 CAGCATCAAACCTCTTGTCTGGG - Intronic
1183915558 22:41115643-41115665 CTGAAGAATTCCTCCTGCCTTGG + Intronic
949688873 3:6611437-6611459 GTAAATAATACCTGTTGCCTTGG + Intergenic
951515162 3:23550864-23550886 CTGTACAATCCCTCTTCTCTGGG - Intronic
951804622 3:26630885-26630907 CTGATTTATACCTACTGTCTTGG - Intronic
951840783 3:27031836-27031858 CTGAAGAAAAACTCTTGTTTGGG - Intergenic
953643910 3:44735920-44735942 CTGAATAAAACCTCATGTTGTGG + Exonic
953686955 3:45085537-45085559 CTGTATAATTCCTCTTCTTTAGG + Exonic
955635942 3:61029776-61029798 CTTAGTAATCCCTCTTGTCCAGG + Intronic
956467035 3:69529457-69529479 CTGCAAATTACCACTTGTCTGGG + Intronic
958671141 3:97206203-97206225 CTGATAAATATTTCTTGTCTGGG + Intronic
963371127 3:144401837-144401859 CTGAATAAAACTTCTAGGCTTGG - Intergenic
966891081 3:184408073-184408095 CTGAACAATACCATTTATCTTGG + Intronic
967205603 3:187117970-187117992 CAGAAAACTACCTATTGTCTTGG + Intergenic
970145037 4:13027099-13027121 GAGAAGAATACCTGTTGTCTAGG - Intergenic
971031045 4:22637153-22637175 GATAATAATACCTCTTGTATAGG + Intergenic
972156626 4:36171056-36171078 CTGAATAATAAACCTGGTCTGGG - Intronic
972325527 4:38011829-38011851 CTGAAGAATACCTCATAACTTGG - Intronic
973366812 4:49214821-49214843 CTGAATAACACCCCTTGACCTGG + Intergenic
973969569 4:56198560-56198582 GAGAATAAGACCTCTTCTCTGGG - Intronic
974423874 4:61714862-61714884 CTGAATCAAAGTTCTTGTCTTGG + Intronic
975101289 4:70516155-70516177 TTGAATAATTCCTCGTGACTGGG - Intergenic
975462362 4:74669226-74669248 CTGAACAAAATCTCTTGTGTTGG - Intergenic
976371483 4:84293555-84293577 CTCAATGATACCTCTCATCTAGG + Intergenic
979233714 4:118375580-118375602 CAGACTAATACATCTTTTCTTGG + Intergenic
982569945 4:157036305-157036327 CTGAAAAATACCTATTACCTAGG + Intergenic
982705494 4:158704655-158704677 CTAAGCAATACCTCTAGTCTCGG - Intronic
983814205 4:172102989-172103011 CTGAAGAAGACCTCTGGTCAAGG + Intronic
984595350 4:181660822-181660844 CTGAATATTAGCTTTTGTATTGG - Intergenic
985230433 4:187810413-187810435 CTGAATTATATCTCTGGACTGGG - Intergenic
988130269 5:27095589-27095611 TTGTAAAATACCTCTTGTCAAGG + Intronic
989679384 5:44011572-44011594 CAGAATAGTACCTATTGCCTGGG - Intergenic
992205270 5:74424606-74424628 TTGAATAACACTTTTTGTCTTGG - Intergenic
992534625 5:77686643-77686665 ATAATGAATACCTCTTGTCTAGG - Intergenic
993162048 5:84304665-84304687 ATGAATGATACATATTGTCTTGG + Intronic
994081792 5:95715360-95715382 TTGAAAAATATGTCTTGTCTTGG - Intronic
994945270 5:106379535-106379557 CTGCATAATTCCTCTTGGCCTGG - Intergenic
995130536 5:108625453-108625475 TTGAATAATATCTCTGTTCTAGG - Intergenic
999863770 5:155678657-155678679 GTGAATAATTCCTATTTTCTAGG + Intergenic
1001524272 5:172417511-172417533 TTGAATAATCCATCTTGACTGGG + Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1005703892 6:28431354-28431376 CTGGTTTATACCTGTTGTCTTGG + Intergenic
1007079633 6:39090161-39090183 CTTAATAATGCTTCCTGTCTCGG - Intergenic
1010107313 6:72184967-72184989 CAGGAAAATAACTCTTGTCTAGG - Intronic
1010639680 6:78309085-78309107 CAGAAAAATTGCTCTTGTCTAGG - Intergenic
1012439326 6:99248133-99248155 CTGATTAATACCTGTCTTCTTGG - Intergenic
1014501945 6:122202518-122202540 CTGAAAAATTCCTATTGCCTAGG + Intergenic
1014501957 6:122202773-122202795 CTGAAAAATTCCTATTGCCTAGG - Intergenic
1014649176 6:124014470-124014492 CTCAATAAGACCTCTAGTCTTGG + Intronic
1015417187 6:132962847-132962869 CTAAATACTTCCTCTTTTCTTGG + Intergenic
1021253537 7:18360939-18360961 CAGAATAATTACCCTTGTCTGGG + Intronic
1021658132 7:22892079-22892101 GGGAATAATACCTTTTTTCTTGG - Intergenic
1023196334 7:37643471-37643493 TAGATCAATACCTCTTGTCTTGG + Intergenic
1024261137 7:47574650-47574672 CTGAATAATACCGTGTGTGTGGG - Intronic
1026357268 7:69569380-69569402 CTAAATAACACTTCTTGGCTGGG - Intergenic
1028231271 7:88309036-88309058 CTGAAAAATTCCTCTTGCCTAGG - Intergenic
1028409780 7:90517095-90517117 CTAAATATTACCACTTTTCTGGG + Intronic
1030197907 7:106870191-106870213 CAGAATAATATCTCATATCTGGG + Intronic
1032700907 7:134378338-134378360 CTTAATTATGGCTCTTGTCTTGG - Intergenic
1035288455 7:157821528-157821550 CTCAAAACTTCCTCTTGTCTTGG - Intronic
1035823056 8:2615846-2615868 CTGAATTATAGCTCTTCTCATGG - Intergenic
1036592008 8:10176879-10176901 CTGTATCATTCTTCTTGTCTGGG + Intronic
1039862580 8:41471536-41471558 CCTAATAAAACCTCATGTCTCGG + Intergenic
1040956877 8:52988522-52988544 CTTAATACCACCTCTTGGCTGGG - Intergenic
1040982054 8:53254053-53254075 CTGAAGAAGACCTGGTGTCTGGG + Intergenic
1043799300 8:84587547-84587569 CTGTAGAATAACTCTTATCTGGG - Intronic
1045623125 8:104006252-104006274 CTTAATAATACCTTCTGGCTGGG + Intronic
1045816688 8:106284515-106284537 CTGAATACTATCTGTTCTCTTGG - Intronic
1047045604 8:121049351-121049373 CTTAATTTTACCTCTTCTCTTGG + Intergenic
1047047959 8:121075985-121076007 CTGACTAATAGCAATTGTCTAGG + Intergenic
1047491881 8:125381964-125381986 CTGACAACTACCGCTTGTCTGGG - Intergenic
1049096357 8:140550547-140550569 CTTAATCACTCCTCTTGTCTGGG + Intronic
1050741647 9:8827092-8827114 TTGATTAATTCCTCTTCTCTAGG + Intronic
1050909211 9:11045844-11045866 CTGACAAAAACCTCTTGACTGGG + Intergenic
1060950447 9:127598863-127598885 AAGAATAATACCTCTTGGCCGGG - Intergenic
1189507858 X:41630970-41630992 CTGAATGATAACTCTGGTTTTGG - Intronic
1194928122 X:99852383-99852405 CTGAAAAATAGCTCCTATCTTGG - Intergenic
1196734539 X:118973072-118973094 CTGCATAGTACCTGTTCTCTGGG + Intergenic
1199051312 X:143240014-143240036 CTTATTTATAACTCTTGTCTAGG + Intergenic
1199417039 X:147597257-147597279 CTGGAAAGTCCCTCTTGTCTTGG - Intergenic
1201162923 Y:11180851-11180873 CTGAATAGCACCTCTTGACCTGG - Intergenic