ID: 1130734515

View in Genome Browser
Species Human (GRCh38)
Location 15:86534184-86534206
Sequence AGTCAGGTCTACAAGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130734509_1130734515 20 Left 1130734509 15:86534141-86534163 CCTTTTCTTTGAGGAACCCAGAT 0: 1
1: 0
2: 0
3: 23
4: 281
Right 1130734515 15:86534184-86534206 AGTCAGGTCTACAAGGAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 127
1130734512_1130734515 3 Left 1130734512 15:86534158-86534180 CCAGATTTTACTTTGGTAGAAAG 0: 1
1: 0
2: 5
3: 20
4: 199
Right 1130734515 15:86534184-86534206 AGTCAGGTCTACAAGGAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 127
1130734511_1130734515 4 Left 1130734511 15:86534157-86534179 CCCAGATTTTACTTTGGTAGAAA 0: 1
1: 0
2: 2
3: 30
4: 304
Right 1130734515 15:86534184-86534206 AGTCAGGTCTACAAGGAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130734515 Original CRISPR AGTCAGGTCTACAAGGAAAC TGG Intronic
902436185 1:16399343-16399365 AGTCAGGATCTCAAGGAAACAGG - Exonic
903441434 1:23390984-23391006 AGTCAGGTAAACAAGGAAAGAGG + Intronic
905391847 1:37640972-37640994 GGACAGATATACAAGGAAACAGG - Intergenic
905771151 1:40638788-40638810 TGTCAGATCCAGAAGGAAACTGG + Intronic
905939477 1:41851842-41851864 AGTCAGGTCTTCCTGGATACAGG + Intronic
921108060 1:212002899-212002921 AATCAGGTATACAAGGAAAAAGG + Intronic
1063038189 10:2309704-2309726 AGTGAAGTCTAGAAGGAAATTGG + Intergenic
1063261391 10:4393156-4393178 CACCAGGTCTTCAAGGAAACAGG - Intergenic
1063810546 10:9700341-9700363 TATGAGGTCTACAAAGAAACAGG - Intergenic
1066346393 10:34591019-34591041 TGGCAGGACTACCAGGAAACAGG + Intronic
1066757231 10:38723147-38723169 AGGCAGGTCCATAAGGTAACTGG + Intergenic
1067544411 10:47182495-47182517 CATGAGCTCTACAAGGAAACAGG + Intergenic
1069283728 10:66688126-66688148 AGACAAGGCTAGAAGGAAACAGG + Intronic
1070165521 10:73894763-73894785 TGTCAGCTCTAAAAGGAGACAGG + Intergenic
1071781657 10:88852897-88852919 AGACAGGTCAGCAAGGAGACAGG - Intergenic
1074886546 10:117698553-117698575 AGAAAGGACTAGAAGGAAACAGG + Intergenic
1076925472 10:133481768-133481790 AGTCAGGGCTACAAGGCAGCAGG + Intergenic
1078531921 11:12143201-12143223 AGACGGTTCTCCAAGGAAACTGG + Intronic
1082873655 11:57966929-57966951 AGACAGGTCCCCACGGAAACTGG - Intergenic
1085200133 11:74696881-74696903 AGTAAGGTATAGAAGGAAAGTGG + Intronic
1085388139 11:76168839-76168861 AGTCAGGGCTAGAAGGAGTCTGG + Intergenic
1091827605 12:3524723-3524745 TGTCCAGTCTATAAGGAAACGGG + Intronic
1091980091 12:4857758-4857780 TGCTAGGTCTCCAAGGAAACAGG + Intergenic
1092767198 12:11863382-11863404 ACAGAGGTCTACAAGGAAAAAGG + Intronic
1093164078 12:15785700-15785722 AGTCATTTCTCCAAGGAATCTGG - Intronic
1094031331 12:26014857-26014879 AGTAAGGTCTCAAAGGAAAAAGG - Intronic
1094274776 12:28660230-28660252 AGTCAGATCTACAAAAAAAAAGG + Intergenic
1100883040 12:99039459-99039481 AGTCAGGTCTTCAAGGAGTTTGG + Intronic
1102970345 12:117161420-117161442 AGTCTGGTCTTCAAGGCAACAGG + Intronic
1112552725 13:100436688-100436710 AGTCAAATCCAAAAGGAAACAGG - Intronic
1113537498 13:111079712-111079734 AGTCAGGTGGAAAAGGAAAGGGG - Intergenic
1114881125 14:26787603-26787625 AGTCAGGTCTTCAAGGGCATTGG - Intergenic
1115464720 14:33702559-33702581 AGTCATGTCGACCATGAAACAGG - Intronic
1115880090 14:37906349-37906371 AGGCAGGTTTACAAGGCAAATGG + Intronic
1116797954 14:49411906-49411928 AGTCATGTCTACAAGGATGATGG + Intergenic
1117312257 14:54539686-54539708 AGTCTGGGCTACAAAGAATCAGG + Intergenic
1118945866 14:70386981-70387003 ATTCAGTTCTAAAAGAAAACAGG + Intronic
1119221087 14:72908028-72908050 AGTAAGGACTATAAGGAAAGAGG + Intergenic
1119441289 14:74630608-74630630 AGTCAGTTGTCCAAGAAAACTGG + Intergenic
1119945030 14:78684468-78684490 AGTCAGGTCTACTTGGAATGAGG + Intronic
1122185889 14:99995644-99995666 AATAAGGTATACAAAGAAACAGG - Intronic
1126033634 15:44525658-44525680 AGTAAGTTGTACAAGTAAACAGG - Exonic
1126195146 15:45923058-45923080 AGTGATGTCTAAAAGGAGACTGG - Intergenic
1130734515 15:86534184-86534206 AGTCAGGTCTACAAGGAAACTGG + Intronic
1137728430 16:50672584-50672606 TGTCAGGTCTACATGGTAAGGGG + Exonic
1140696896 16:77543582-77543604 AGAAAGTTCAACAAGGAAACAGG + Intergenic
1142146558 16:88495255-88495277 AGGCTGGGCCACAAGGAAACAGG + Intronic
1143286098 17:5790430-5790452 GCTCAGGTCTACAAGGCCACTGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1146707674 17:35013368-35013390 GGTCAGCTCTACTAGGATACTGG - Intronic
1148542859 17:48493733-48493755 AGTCTTGTGTAAAAGGAAACTGG + Intergenic
1151723977 17:75874281-75874303 AGTGAGGTCTGCAGGGGAACAGG + Exonic
1152720931 17:81923536-81923558 AGGCAGGCCTAGAAGGAAGCCGG + Intronic
1157287804 18:46389158-46389180 AGTGAGGACCACAAGGAAACAGG + Intronic
1161987077 19:7661784-7661806 AGTCATGTCTTCAAGGAGGCAGG + Intergenic
1164382878 19:27750286-27750308 AGTCTGGTTTACAAAAAAACTGG - Intergenic
1165440576 19:35824729-35824751 AGTCTGTTCTTCATGGAAACAGG + Intergenic
1165753089 19:38273412-38273434 AGTCAGGAGTTCAAGAAAACAGG - Intronic
1165931230 19:39360577-39360599 CCTCAGGTCTACTAGAAAACAGG - Intronic
1166174128 19:41053600-41053622 AGTCTGGTGTACAAGGAACTAGG + Intergenic
1167403818 19:49290749-49290771 CGTCAGGTCTGCAAGGAACCTGG + Exonic
925956749 2:8973816-8973838 TGTCAAGTGTATAAGGAAACAGG + Intronic
927444156 2:23142914-23142936 AGACAGGGCTACAAGGAATCTGG + Intergenic
928036678 2:27830615-27830637 ACTCTGGTCTTTAAGGAAACTGG - Intronic
929080388 2:38116580-38116602 AGTGAGGTCTAAAAGAAGACTGG + Intergenic
930025354 2:47026082-47026104 AATGAGGTCTCCAAGGAAACTGG - Intronic
931226576 2:60337056-60337078 AGTGATGTCTTCAAGGAATCAGG + Intergenic
934051713 2:88216703-88216725 AGACAGGCATACCAGGAAACAGG - Intergenic
934235295 2:90226553-90226575 AGTCAGGTCTGCAGAGAAAGGGG + Intergenic
934320534 2:91967588-91967610 AGGCAGGTCCATAAGGTAACTGG + Intergenic
937745948 2:125415477-125415499 AGTCATGTCTATGAGGAAAGAGG - Intergenic
941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG + Intronic
942247533 2:174021484-174021506 AGTCATGTCAAAAAGGACACAGG + Intergenic
1169248654 20:4043979-4044001 AGTCATTTCCACAAGGACACAGG - Intergenic
1169922667 20:10751958-10751980 AGTCAACTCAACAAGGAAAATGG - Intergenic
1172617567 20:36299220-36299242 AGAGATGTCTCCAAGGAAACAGG + Intergenic
1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG + Intronic
1176366379 21:6035422-6035444 AGCCACGTCTACAAGCAAAGAGG - Intergenic
1178186075 21:30222312-30222334 TGTCAGTTTTACTAGGAAACTGG + Intergenic
1179757138 21:43503123-43503145 AGCCACGTCTACAAGCAAAGAGG + Intergenic
1184213909 22:43053639-43053661 AGTGAGGCAGACAAGGAAACAGG - Intronic
1184895061 22:47401831-47401853 AGCCAGGCCTGCAATGAAACTGG - Intergenic
949526566 3:4910462-4910484 AGAGAGGTAGACAAGGAAACAGG + Intergenic
952683294 3:36120875-36120897 AGTCATCTATACTAGGAAACAGG - Intergenic
953245017 3:41183059-41183081 AGAAAGGTCTGTAAGGAAACAGG + Intergenic
953294547 3:41700685-41700707 ACTCAGGCCTCCAAGAAAACAGG + Intronic
959882254 3:111457294-111457316 AGGAAGGTTTAGAAGGAAACTGG - Intronic
961499273 3:127319922-127319944 AGCAAGGTCTCCAAGGAAGCGGG + Intergenic
961640539 3:128362064-128362086 AGTCATGTCTTCAAAGAATCTGG + Intronic
961987122 3:131147158-131147180 AGTCAGCTTTAAAAGAAAACAGG - Intronic
962790807 3:138809911-138809933 AGTCATTTCTCCAAGGGAACTGG - Intronic
962884445 3:139611165-139611187 AGAAAGGTCTAAAAGAAAACAGG + Intronic
963670759 3:148249027-148249049 AGGCAGGGGTGCAAGGAAACAGG - Intergenic
964147445 3:153482632-153482654 AGTGAGGTCTGCAAGAAAAGAGG + Intergenic
965940067 3:174168940-174168962 AGTCAGGTCCACAAGGCATCTGG - Intronic
966381822 3:179352398-179352420 AGACAGGCCTAGAAGGAAAGAGG + Intronic
968038044 3:195565139-195565161 AGTCAGGTGTCCAAAGAAATAGG - Intergenic
968911321 4:3478206-3478228 AAGCAGGTCTCCAAGGAAACGGG - Intronic
971736832 4:30464334-30464356 AGGCAGGTCTAGCAGAAAACAGG + Intergenic
976152867 4:82110273-82110295 AGTCAAGAATACAATGAAACTGG - Intergenic
976586938 4:86809116-86809138 GGTGAGGTCTAAGAGGAAACAGG + Intronic
979909002 4:126336092-126336114 AGTCAGGTCTACTATTATACAGG + Intergenic
984469056 4:180142743-180142765 AGTGAGGTCTACAAAGCTACAGG + Intergenic
985836381 5:2275118-2275140 CGTCAGGTCCTGAAGGAAACTGG - Intergenic
986674266 5:10169313-10169335 AGTCAGGCCTCCCAGGAGACAGG + Intergenic
994389487 5:99174485-99174507 AGTCAGGTCTAGAGGTAAATTGG - Intergenic
996764232 5:127019688-127019710 AGTGATGTCATCAAGGAAACAGG - Intronic
996801476 5:127408335-127408357 AGTCAGTTCCAAAAGGAAAAAGG - Intronic
996873576 5:128217351-128217373 AGTCAGATCTTCCTGGAAACTGG + Intergenic
1003009294 6:2411194-2411216 AATCAGGTCTACATGTAAAGAGG + Intergenic
1005039952 6:21592600-21592622 AGCCAGGTCTACTATGAATCCGG + Intergenic
1007047265 6:38789692-38789714 TGACAGGACTACGAGGAAACTGG + Intronic
1014293761 6:119592561-119592583 AGCCAGATCTACAAAGAATCAGG - Intergenic
1015265191 6:131284588-131284610 ATTCAGGGCTGCAAGGAAGCTGG - Intergenic
1015606415 6:134959642-134959664 AGTCAAATCTACAAAGGAACAGG - Intergenic
1018569652 6:165195639-165195661 TGTTAGGTCTAGAAGCAAACAGG - Intergenic
1020413116 7:7915210-7915232 AGTAAGGTCTACAAGGGGAAGGG - Intronic
1024009686 7:45257166-45257188 AGGCAGGTCTGGAAGGAACCAGG - Intergenic
1027761972 7:82290332-82290354 AGACAATTCGACAAGGAAACAGG + Intronic
1029412085 7:100419806-100419828 AGTTAGGGCTACAAGGTAACAGG + Exonic
1030636534 7:111955061-111955083 AGTCATGTATACCAGAAAACAGG + Intronic
1031436275 7:121736118-121736140 AGTCAATTCTATAAGGCAACTGG - Intergenic
1033952618 7:146803887-146803909 AGGGAGCTCTACAAGGAGACAGG - Intronic
1038036242 8:23689247-23689269 AATAAGGTTTACAAGAAAACTGG - Intergenic
1038072068 8:24028196-24028218 AGTCAGGTCTTCATGGTAAGAGG + Intergenic
1044025808 8:87170678-87170700 AGCTGGGTATACAAGGAAACTGG - Intronic
1044083411 8:87913008-87913030 AGTCAGGTTTGCATGGAAGCGGG - Intergenic
1047198208 8:122740703-122740725 TGCCAGGTGTACAAGGAAAGAGG - Intergenic
1051579403 9:18654318-18654340 AGTAACATCTTCAAGGAAACTGG + Intronic
1051687449 9:19673094-19673116 AGACAGGTCTTCAAGGCAAAAGG - Intronic
1055317054 9:75044123-75044145 AGTAAAGTCTACAATGAAAAAGG + Intergenic
1056306589 9:85296644-85296666 AGTCAGGACCACAAGGAAGGAGG - Intergenic
1056453226 9:86736550-86736572 ATTCTGGTCAACAGGGAAACTGG + Intergenic
1058348837 9:103997648-103997670 AGTCATATCTATAATGAAACTGG - Intergenic
1061623435 9:131826266-131826288 AATAAGGTCTACAAGGAAGGAGG + Intergenic
1062066324 9:134528488-134528510 AGTCAGGTCTCCGATGAAAGAGG + Intergenic
1186564184 X:10644857-10644879 AGAGAGGTTTAAAAGGAAACTGG - Intronic
1187389096 X:18874190-18874212 TTTCAGGTCAACAAGGAATCTGG - Intergenic
1196735619 X:118978620-118978642 ACTCAGGTCTGCAAGGGAGCTGG + Intronic
1201188038 Y:11422693-11422715 AGTCAGGTCCATAAGGTAACTGG + Intergenic