ID: 1130737799

View in Genome Browser
Species Human (GRCh38)
Location 15:86568821-86568843
Sequence AAGGGTCAAGCATAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130737793_1130737799 14 Left 1130737793 15:86568784-86568806 CCCTTGGTCAAAGAGGTGAGGTA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1130737799 15:86568821-86568843 AAGGGTCAAGCATAGGAAGTTGG 0: 1
1: 0
2: 0
3: 3
4: 150
1130737794_1130737799 13 Left 1130737794 15:86568785-86568807 CCTTGGTCAAAGAGGTGAGGTAG 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1130737799 15:86568821-86568843 AAGGGTCAAGCATAGGAAGTTGG 0: 1
1: 0
2: 0
3: 3
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130737799 Original CRISPR AAGGGTCAAGCATAGGAAGT TGG Intronic
900808804 1:4785674-4785696 AGGGGTCAAGCAGAGGAAAGAGG - Exonic
900867919 1:5281889-5281911 AAGAGTAAAGAATATGAAGTTGG + Intergenic
901392572 1:8956703-8956725 AAGGTATAAGAATAGGAAGTGGG - Intronic
902605658 1:17567910-17567932 GAGGGTCAAGGACAGGAAGGGGG - Intronic
902682277 1:18051776-18051798 ATGGGGCCAGCAAAGGAAGTGGG - Intergenic
902740986 1:18437839-18437861 AAGGGGCATGCATAGGCAATTGG + Intergenic
903827619 1:26156951-26156973 AGGGGTTAAGCATGGGAGGTGGG - Intergenic
906958154 1:50394091-50394113 ATGGCTCAAGCAGAGGATGTTGG - Intergenic
910198603 1:84673444-84673466 AAGGCTACAGCGTAGGAAGTCGG + Intronic
912491208 1:110063827-110063849 AAGTGTCAAGCACATGAAGGTGG - Intronic
914400390 1:147314618-147314640 AAGGGCCATGCCTTGGAAGTGGG + Intergenic
914971227 1:152309414-152309436 CAGGGTCAAGCAGAGGAGGAAGG - Exonic
915741232 1:158120002-158120024 AAGGGGTAAGCATTGGAAGCAGG + Intergenic
922665578 1:227465848-227465870 ACAGGACAGGCATAGGAAGTCGG + Intergenic
923102956 1:230831671-230831693 AAGGGCCATGCATTAGAAGTGGG - Intergenic
924472506 1:244355044-244355066 CAGGGTCAGGCAAAGGCAGTTGG + Intronic
1063438444 10:6053212-6053234 AAGGGGCTAGGATAGGAAGCAGG - Intronic
1064322651 10:14320184-14320206 AATGGGCAGGCATGGGAAGTGGG - Intronic
1069048234 10:63765140-63765162 AAGGGCTAAGCATATGAAATTGG + Intergenic
1070443237 10:76466993-76467015 AATGGCTAAGAATAGGAAGTTGG - Intronic
1072902559 10:99421483-99421505 AAGGGTGAGGCAGATGAAGTGGG - Intronic
1073547354 10:104362154-104362176 AATGGACCAGCATAGCAAGTAGG + Exonic
1073625364 10:105091130-105091152 AAGGGGCAAGGAAAGGAAGGAGG - Intronic
1077928097 11:6702498-6702520 TAGGGTCAAGCATTGGAATGAGG + Intergenic
1082849010 11:57748864-57748886 AAGTGTCATACAAAGGAAGTAGG - Intronic
1083664319 11:64266381-64266403 GAGGGACAAGCATAAGAAGGAGG + Exonic
1086316416 11:85599120-85599142 AAGGGTCATGTTAAGGAAGTTGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1087810490 11:102604987-102605009 AAGGCTTCAGCATAGGAATTTGG - Intronic
1088235966 11:107723221-107723243 AAGAATCAATCATAGGAACTTGG - Intergenic
1090170985 11:124604229-124604251 AAAGGTCAAGCTTAGGAACAGGG + Intergenic
1090200087 11:124847698-124847720 AAGGGTGAAGTAGAGGAAGGTGG - Intergenic
1090420142 11:126569095-126569117 GTGGGTCAAGCAGAGGAAGAGGG + Intronic
1094435401 12:30415534-30415556 GAGGGACCAGCAAAGGAAGTTGG - Intergenic
1095651933 12:44621185-44621207 AAGAGTTAAGCAAAGAAAGTGGG - Intronic
1098775679 12:74611884-74611906 ATGAATCAAGTATAGGAAGTTGG + Intergenic
1100530303 12:95456094-95456116 AAAGGTCAAGCTGAGGAGGTAGG + Intergenic
1100540424 12:95552242-95552264 AAGGATTGAGCAGAGGAAGTGGG + Intergenic
1102540427 12:113615089-113615111 AAGTCCCAAGCATAGGGAGTTGG + Intergenic
1103118346 12:118357683-118357705 GGGGGTGAAGCAGAGGAAGTGGG - Intronic
1109873595 13:68368045-68368067 CAAGGTCAGGCAAAGGAAGTTGG + Intergenic
1112662973 13:101534669-101534691 AAGGCTGAAGCTTAGGAAGAGGG + Intronic
1114414420 14:22531145-22531167 AAGAGGAAAGCATAGGAAATTGG - Intergenic
1114911435 14:27203895-27203917 AAGGGCAAAGCAAAAGAAGTTGG + Intergenic
1115518286 14:34207174-34207196 AAGGGTAAAACGTAGGAACTGGG - Intronic
1118043133 14:61938642-61938664 AAGAGACAAGCAAAGGAATTTGG + Intergenic
1120681811 14:87489127-87489149 AAGGGTCAGGCATAAAAAATGGG + Intergenic
1120834944 14:89030984-89031006 AGGGGTGAAGCAAAGGAAGGGGG + Intergenic
1121832685 14:97065762-97065784 AAGGGTCAGGCACAGGAATTGGG + Intergenic
1130737799 15:86568821-86568843 AAGGGTCAAGCATAGGAAGTTGG + Intronic
1133130932 16:3675786-3675808 AAGGGCCACGCAGAGGAAGGAGG + Intronic
1133841685 16:9415856-9415878 AAGGGGCAAGCATAGAACCTGGG + Intergenic
1138834107 16:60412477-60412499 AAGGGTCAAAATCAGGAAGTCGG - Intergenic
1139940068 16:70598874-70598896 ATAGCTCAAGCATAGGCAGTGGG + Intronic
1142493604 17:294078-294100 AAGGGGAAAGCACAGGACGTGGG + Intronic
1145279620 17:21457965-21457987 CAGGGGCAGGCACAGGAAGTAGG + Intergenic
1145398259 17:22512527-22512549 CAGGGGCAGGCACAGGAAGTAGG - Intergenic
1148536671 17:48444820-48444842 AAAGGTGAAGGACAGGAAGTGGG + Intergenic
1149214862 17:54342346-54342368 AAGGGACAATATTAGGAAGTGGG + Intergenic
1149393463 17:56215489-56215511 AAGGGACAAGAACAGGAAGATGG + Intronic
1149404982 17:56339451-56339473 GAGGGTGAAGGATAGGAAGAGGG - Intronic
1150005907 17:61468914-61468936 CCTGGCCAAGCATAGGAAGTTGG - Intronic
1150146512 17:62773995-62774017 GAGGGTCAAGCACAGGACCTAGG + Intronic
1151849027 17:76678794-76678816 AAGGGTGAAGCAAAGGAATATGG - Intronic
1153243081 18:3048252-3048274 AAAGTAGAAGCATAGGAAGTGGG + Intergenic
1155213854 18:23625201-23625223 AAGGGACAATCATAAGAAATAGG - Intronic
1157290171 18:46404341-46404363 GTGGGTCAAGGATAGGAAGAAGG + Intronic
1157799368 18:50606305-50606327 AAGTGTCAAGCAGAGGAGTTGGG + Intronic
1167843142 19:52138786-52138808 AAGGAGGAAGCCTAGGAAGTTGG - Intronic
1168468146 19:56620418-56620440 AAGGGTGGAGAATAGAAAGTGGG + Intronic
925280762 2:2682994-2683016 CAGGGAGAAGCAGAGGAAGTAGG + Intergenic
925358669 2:3261920-3261942 AAGAATCAAGGATATGAAGTGGG + Intronic
927558675 2:24053631-24053653 AAGGGGCAATCAAAGAAAGTGGG + Intronic
931920065 2:67005517-67005539 AAGGGAGCAGCATAGGAAGAAGG + Intergenic
943877064 2:193081350-193081372 AAGGGCCAGGCATTGGAGGTGGG - Intergenic
944304434 2:198163603-198163625 AAGGATCATGCTTAGGAATTTGG - Intronic
944483986 2:200184283-200184305 AAGAGACAGGCAGAGGAAGTGGG - Intergenic
947040339 2:225911195-225911217 AAGAATTAGGCATAGGAAGTAGG - Intergenic
1169300600 20:4438989-4439011 GAGGGGCAAGCAAAGGAAGAGGG + Intergenic
1173562295 20:44014695-44014717 AAGTGTCACGCATAGGCAATTGG + Intronic
949315812 3:2753551-2753573 AAGGGACCAGCATAGGAACCTGG + Intronic
951843327 3:27058525-27058547 CAGGGGCAAGCTTATGAAGTTGG - Intergenic
952742077 3:36743792-36743814 ATGTGTCAAGCAGAGGAATTTGG - Intergenic
953542407 3:43833507-43833529 AAGGGACAGGCATAGGAAACAGG - Intergenic
954803176 3:53199190-53199212 GAGGGACAAGGATAAGAAGTAGG + Intergenic
961558940 3:127715617-127715639 AAGAGCTAAGCAGAGGAAGTGGG + Intronic
961953287 3:130772836-130772858 AAAGGTAAGGCATAGGATGTAGG + Intergenic
961994534 3:131228123-131228145 AAGTTTTTAGCATAGGAAGTTGG - Intronic
962332790 3:134494454-134494476 AAGGGTCTAGCAGAGAAAGAGGG - Intronic
965333310 3:167404595-167404617 AAGGGACAAGGAAAAGAAGTTGG + Intergenic
969093270 4:4712871-4712893 AAGGGTCAAGCACTGGTACTGGG - Intergenic
971504141 4:27347947-27347969 AAGGGGGAAGCATAGAGAGTAGG - Intergenic
973086586 4:46070153-46070175 CAGGGTCAATCATTGGAAATTGG - Intronic
973956458 4:56068105-56068127 AAGGATCAGGCATAGGAGGTTGG + Intergenic
976183013 4:82416889-82416911 AAGGGTGAATCAAAAGAAGTAGG - Intergenic
976276660 4:83285136-83285158 AAGAGTCGAGCGGAGGAAGTTGG + Intergenic
976350007 4:84050545-84050567 AAGGTTCATGGATAGGAAGAGGG + Intergenic
976504301 4:85828894-85828916 AAGGGAAAAGTATAGGAATTTGG + Intronic
977247065 4:94645064-94645086 AAGGGGAAAGGATGGGAAGTGGG - Intronic
979155583 4:117385024-117385046 AAGGGTAATGCAGTGGAAGTAGG + Intergenic
982138693 4:152296806-152296828 ATGGGTCAAGGATAGGGAGGGGG + Intergenic
990375714 5:55168404-55168426 AAGGGTCAAGCAGAGGGAAAAGG - Intronic
990853827 5:60240389-60240411 AAGAGTCAAGCCTTGGAACTGGG - Intronic
992784947 5:80160698-80160720 AAGACTCAAACATAGGAAGGAGG - Intronic
993982869 5:94564066-94564088 TAGTGTCAAGTATAGGAGGTTGG - Intronic
995297684 5:110539627-110539649 AAGGCCCAAGCATAGAAAGGGGG - Intronic
995828057 5:116323530-116323552 AAGGGTCAAGCCTTAGAAATGGG + Intronic
998261302 5:140633701-140633723 TAGGTTCAAGAAAAGGAAGTTGG + Exonic
998618331 5:143766359-143766381 AAGAGTCAAGCAGAGAGAGTTGG - Intergenic
999758964 5:154685516-154685538 AAGGGTTTAGCGTAGAAAGTGGG + Intergenic
1002126945 5:177052766-177052788 AAAGCTGAACCATAGGAAGTTGG - Intronic
1002689979 5:181043984-181044006 AAGGTTCAAGGACAGGAGGTGGG - Intronic
1003596239 6:7476615-7476637 AAGGTTCAGGCAGAGGAAGAGGG + Intergenic
1003737460 6:8892882-8892904 ACAGATCCAGCATAGGAAGTCGG - Intergenic
1004186596 6:13426526-13426548 AAGGGACAGGCAATGGAAGTGGG - Intronic
1005281381 6:24278387-24278409 AAGGGTCTAGGAGAGGAAGGAGG + Intronic
1006088836 6:31615965-31615987 GAGGGGCAGGCAGAGGAAGTGGG - Intronic
1008241891 6:49123878-49123900 ATGAGCCAAGCATAGGAGGTGGG + Intergenic
1013356785 6:109352276-109352298 AAGGGAGAAGGATAGGAAGACGG - Intergenic
1017359652 6:153552750-153552772 CAGGGTCCAGCATAGGACCTTGG + Intergenic
1017868925 6:158469768-158469790 AAGGGCCAAGCATAGAACTTTGG + Intronic
1018230956 6:161674880-161674902 AAGAGTCAAGGGTAGGAAGGAGG + Intronic
1023219632 7:37906090-37906112 AAGGGCCAAGCAAAGGAGGCAGG + Exonic
1023622927 7:42091222-42091244 AAGGGTGAAGCAGAGAAGGTTGG - Intronic
1026401459 7:70017991-70018013 GAGGGTCAAGAATAGAAACTGGG + Intronic
1027426120 7:78062835-78062857 AAGGGCCAAGCTTAGGCAGAAGG - Intronic
1030190459 7:106805499-106805521 ATGGGGCTAGCAGAGGAAGTGGG + Intergenic
1030946282 7:115725655-115725677 AAGGGTCAACCACATGATGTGGG - Intergenic
1031575999 7:123416589-123416611 AAGGGGTAAGCAAAGCAAGTAGG + Intergenic
1035289880 7:157831138-157831160 AAGGGAGAAGCACAGGAAGAGGG + Intronic
1036919816 8:12841441-12841463 AAGGGTTAAACATGGGAGGTGGG - Intergenic
1042256788 8:66812799-66812821 AAAGTTCAAGGTTAGGAAGTAGG + Intronic
1045490949 8:102668811-102668833 AAGGGAAAAACATAGGAAATAGG + Intergenic
1045701114 8:104867046-104867068 AAGGGTCTAGCATAGTACCTGGG + Intronic
1046562759 8:115860102-115860124 AAAGGCCAAGCAGAGAAAGTGGG + Intergenic
1050103474 9:2142285-2142307 CAACGTCAAGCAAAGGAAGTTGG + Intronic
1051169414 9:14304276-14304298 AAAAGAAAAGCATAGGAAGTTGG + Intronic
1051804332 9:20974927-20974949 AAAGGAGAAGCATAGGAAGAAGG - Intronic
1053459099 9:38254723-38254745 AAGGGCCTTGCACAGGAAGTTGG + Intergenic
1054740044 9:68796728-68796750 AAGGCTGGAGCATAGGAAGTGGG + Intronic
1056063921 9:82913886-82913908 AAGAGCCAAGCTTTGGAAGTTGG + Intergenic
1058213977 9:102209150-102209172 AAGTGTCAAACATGGAAAGTGGG - Intergenic
1058298491 9:103340086-103340108 AGGGGTCATGAATAGGAGGTTGG - Intergenic
1059001725 9:110355680-110355702 AAGGTTCAAGTATAGCAAGCTGG + Intergenic
1059568655 9:115410258-115410280 AAGGGTTAAGCAAACGGAGTGGG - Intergenic
1060875860 9:127083188-127083210 AAGGGAGAAGCAGCGGAAGTAGG - Intronic
1061603864 9:131693611-131693633 ATGGGCCAAGCAGAGGAGGTTGG - Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1191731365 X:64339225-64339247 AAAGGGCAAGCAGAGGAAGGAGG + Intronic
1193750688 X:85339547-85339569 GAGGGTCAAGAAAAGTAAGTGGG + Intronic
1195119198 X:101733166-101733188 AAGGGTCAAGGATAGGGTGAGGG + Intergenic
1198029101 X:132737708-132737730 AAGGGGCAAGCATAGGTGTTTGG + Intronic
1199593844 X:149491720-149491742 CAGGGGCTAGCATAGGAAGGAGG - Intronic
1200035286 X:153323242-153323264 AAGGGGCAAGCATAAGAAAGTGG - Intergenic