ID: 1130744575

View in Genome Browser
Species Human (GRCh38)
Location 15:86637428-86637450
Sequence CAGATGAAGGTGAATGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130744575 Original CRISPR CAGATGAAGGTGAATGAGGC CGG Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901738784 1:11328944-11328966 CAGATGAGAGTGAAGGAGTCAGG - Intergenic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
901911858 1:12465258-12465280 CAGATGAAGATTTATGAAGCTGG + Intronic
902027655 1:13395585-13395607 CTGAGGCAGGTGAATCAGGCAGG + Intergenic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
902241573 1:15093615-15093637 AAGATAAAGATAAATGAGGCAGG + Intronic
902618233 1:17635443-17635465 CAGAGGGAGGTGAGTGAGGCAGG - Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
903288519 1:22292192-22292214 CACATGAAGGGGAAAGACGCTGG + Intergenic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
906533266 1:46535991-46536013 CAGATGTTGATGAATGAGGTTGG - Intergenic
908803225 1:67902260-67902282 CAGATGTAGGAGAATGAAACTGG - Intergenic
908936192 1:69379175-69379197 CTTTTGAAGGTGAATAAGGCTGG - Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
915271440 1:154756476-154756498 CAGATGAAGGGGGGTGTGGCAGG - Intronic
915404214 1:155647041-155647063 TACAAGAAAGTGAATGAGGCTGG + Intergenic
915506257 1:156358260-156358282 CAGATAGAGGTCAATGAGACAGG + Intronic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917279515 1:173367821-173367843 CAGGTGTAGGTCAAGGAGGCAGG - Intergenic
917370579 1:174289689-174289711 CATATGCAGGTAAGTGAGGCTGG + Intronic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918219288 1:182421279-182421301 CATATGCAGATGAATGAGACTGG - Intergenic
918367977 1:183829149-183829171 CTGATGAAGGTGGATCAGCCAGG + Intronic
918795152 1:188884929-188884951 GAGATGATGTAGAATGAGGCAGG + Intergenic
919749505 1:201028186-201028208 CACATGAGTGTGAATGAGGCTGG + Intergenic
920067836 1:203281742-203281764 CAAATGAAGGTGAATAAGACAGG - Intergenic
920541256 1:206779797-206779819 AAGAAGAAAGTCAATGAGGCTGG - Intergenic
921373299 1:214447922-214447944 CAGATGAAGGTTGATAAGGAGGG - Intronic
921427544 1:215021843-215021865 CAGATGAAGATGGTTGTGGCCGG - Intronic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922743190 1:228027970-228027992 CACATGTAGGTGAATGAAACTGG - Intronic
923212969 1:231822471-231822493 CAGTTGAAGGGCAATGAGGTTGG + Intronic
923427277 1:233883706-233883728 CAGATGAAGAGGGTTGAGGCAGG - Intergenic
924447208 1:244144417-244144439 CAGATTACAGTGACTGAGGCTGG - Intergenic
1066217207 10:33299435-33299457 CAGATCAAGATGTCTGAGGCAGG + Intronic
1067034934 10:42907512-42907534 CATATGAAGCTGAATGAAACTGG + Intergenic
1067319048 10:45199604-45199626 CAGATGCGGGTGAACGAGGAAGG - Intergenic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1069026312 10:63546060-63546082 CACATGGAGGTCAATGTGGCTGG + Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1070874249 10:79787461-79787483 CAGCTGAAGGAGAATTAGACTGG + Intergenic
1073127511 10:101160869-101160891 CAGAGGAAGATGGATGTGGCAGG - Intergenic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1074801692 10:117006109-117006131 CAGATGAAGTTCAAAGATGCAGG - Intronic
1075256929 10:120932705-120932727 CAGATGGAGGTGAATTTGGAAGG - Intergenic
1076108069 10:127840326-127840348 CAAATGAAGATGCATGAGGTAGG + Intergenic
1076792616 10:132785266-132785288 CAGGTGAAGGTGAGCGCGGCGGG - Exonic
1077202030 11:1313567-1313589 CAGATGAAGAAGAATGAAACTGG - Intergenic
1077225078 11:1436126-1436148 CTGATGAAGGTGGGTGGGGCCGG + Exonic
1077426924 11:2484920-2484942 CAGGTGAAGGTGAGAGAGCCAGG - Intronic
1077775750 11:5269817-5269839 AAGATGAATGTGGAAGAGGCTGG - Exonic
1077901892 11:6496806-6496828 AAAATTAAGTTGAATGAGGCCGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1079848845 11:25503631-25503653 CATACGAAGATGAATGAAGCTGG - Intergenic
1081343013 11:41950714-41950736 CATATGCAGATGAATGTGGCAGG + Intergenic
1081700884 11:45151888-45151910 GAGATGGAGGTGGATGAGGCTGG + Intronic
1081812346 11:45921199-45921221 CAGATGAAGATCAGGGAGGCTGG + Intergenic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1084751105 11:71204919-71204941 CAGATGGAGATGAGGGAGGCAGG + Intronic
1084829553 11:71758405-71758427 GAGATGATGGTGGCTGAGGCTGG + Intergenic
1085751674 11:79167688-79167710 CAGTTGGAGGTGAAGGTGGCAGG + Intronic
1086511987 11:87568689-87568711 CAGATGTAGAAGAATGAAGCTGG + Intergenic
1088180019 11:107098662-107098684 CACATGAAGGAGAATGAAACTGG + Intergenic
1089173791 11:116534254-116534276 CAGATAAATGTGAAAGAGACAGG + Intergenic
1089883977 11:121801586-121801608 CAAATGAGTGAGAATGAGGCAGG + Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090572384 11:128061453-128061475 CAGAAGAACTTGAATGAGGCTGG + Intergenic
1090819996 11:130333280-130333302 TAGATAAAACTGAATGAGGCTGG - Intergenic
1092762462 12:11822123-11822145 CATGTCAAGGTGAATGAGACTGG - Intronic
1094465812 12:30753601-30753623 CAGATGAGGCTGAAGGAGGTGGG + Exonic
1095149149 12:38770639-38770661 CAGTTGAAGGTGGAAAAGGCTGG - Intronic
1095203326 12:39410957-39410979 AAGATGAATCTGAATGAGGGTGG - Intronic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1095733112 12:45526836-45526858 CACATGTAGGAGAATGAAGCTGG + Intergenic
1095952255 12:47787996-47788018 CAGGAGGAGGTCAATGAGGCTGG + Intronic
1096114230 12:49045919-49045941 CCCATGAAGGTGAAAGAGCCAGG - Exonic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096800103 12:54104898-54104920 GACATGAAGTTGAATAAGGCAGG - Intergenic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1097295920 12:57962717-57962739 CACATGTAGGAGAATGAAGCTGG + Intergenic
1097556377 12:61143940-61143962 CACATGATGATGAAGGAGGCTGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099236610 12:80090308-80090330 CATATGAAGGAGAATGAAACTGG + Intergenic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1102492332 12:113296814-113296836 CGGAGGAAGGGGCATGAGGCAGG + Exonic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1103087731 12:118074378-118074400 CAGATAAAGGGGACTGGGGCCGG - Intronic
1103282570 12:119772033-119772055 CAGATGAATGTGGGTGAGGATGG + Intronic
1104161464 12:126185198-126185220 CAGATGGTGGGAAATGAGGCAGG - Intergenic
1104260114 12:127174520-127174542 GAGATGAAGGTGCATGAGCTGGG - Intergenic
1105252067 13:18708212-18708234 CAAATGAGGGTCAATGAGGTTGG + Intergenic
1105872189 13:24515202-24515224 AAGATGAGGGTGAAGGTGGCAGG + Intergenic
1105915726 13:24914252-24914274 CAGATGAAGGTTAGGAAGGCTGG - Intronic
1106139778 13:27002476-27002498 CAGGAGAGGGTGAATGTGGCTGG - Intergenic
1106829349 13:33562602-33562624 CATATGAAGATGAATAAGACAGG - Intergenic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1109226223 13:59699373-59699395 CAGCTGAAGGGGAGTGAGCCAGG + Intronic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1111109121 13:83684495-83684517 CAGCTGAATGGGAATGCGGCGGG - Intergenic
1111896793 13:94152088-94152110 CAGATGAATTTGAATAATGCAGG + Intronic
1111942773 13:94630630-94630652 TTGATGAAGGACAATGAGGCTGG - Exonic
1112241980 13:97691220-97691242 CAGATGAAGGTGAAAATGACTGG - Intergenic
1112266644 13:97930265-97930287 AAGATGAAGATGAAATAGGCTGG - Intergenic
1114326783 14:21597150-21597172 CAAATGCAGGAGAATGAAGCTGG + Intergenic
1114906499 14:27134542-27134564 CACATGCAGAAGAATGAGGCTGG + Intergenic
1115475574 14:33810148-33810170 CATCTGCAGGTGAAAGAGGCAGG + Intergenic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115959079 14:38814507-38814529 CACATGTAGGAGAATGAAGCTGG + Intergenic
1118162717 14:63306731-63306753 CAAATGTAGGAGAATGAGACTGG + Intergenic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118778986 14:68993675-68993697 CAGATCATGGTAAGTGAGGCAGG + Intergenic
1120816822 14:88869583-88869605 CACACGAAGGTAAATGAGGCTGG - Intronic
1120968783 14:90190692-90190714 CTGATGATGCTGAATGAGGCGGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122377446 14:101273646-101273668 CACATGTAGGTGAATGAAACTGG - Intergenic
1122802885 14:104240510-104240532 CAGGGGGAGGGGAATGAGGCTGG - Intergenic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1123469410 15:20538990-20539012 CAAAGGAAGGTGACTGAGGGTGG + Intronic
1123648651 15:22461709-22461731 CAAAGGAAGGTGACTGAGGGTGG - Intronic
1123682663 15:22773739-22773761 CAAAGGAAGGTGACTGAGGGTGG + Intronic
1123729688 15:23133976-23133998 CAAAGGAAGGTGACTGAGGGTGG + Intronic
1123747855 15:23331458-23331480 CAAAGGAAGGTGACTGAGGGTGG + Intergenic
1123762633 15:23444514-23444536 CAAAGGAAGGTGACTGAGGGTGG + Intronic
1124176387 15:27428468-27428490 CACATGAATGTGAATTAGGTGGG + Intronic
1124280223 15:28355310-28355332 CAAAGGAAGGTGACTGAGGGTGG + Intergenic
1124302476 15:28556302-28556324 CAAAGGAAGGTGACTGAGGGTGG - Intergenic
1124334413 15:28846263-28846285 CAAAGGAAGGTGACTGAGGGTGG + Intergenic
1125575610 15:40753662-40753684 CAATTGAAGCTGAATGTGGCTGG - Intronic
1126858887 15:52864930-52864952 CAGAAGGAGGTAAGTGAGGCTGG - Intergenic
1126928569 15:53620592-53620614 CACATGAAGGTGAATGAAACTGG + Intronic
1127617560 15:60702080-60702102 CAGATGATGGAGTTTGAGGCTGG + Intronic
1129118242 15:73378354-73378376 GAGAGGGAGGTGAGTGAGGCTGG + Intergenic
1129797938 15:78392151-78392173 GAGATGAGGATGAATGAGGATGG - Intergenic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1131154112 15:90064269-90064291 GACAGCAAGGTGAATGAGGCAGG - Intronic
1132205024 15:99980561-99980583 GAGATGCAGGGGAGTGAGGCGGG - Intronic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132822866 16:1885407-1885429 CAGAGGAAGGGGAGTGAGGGGGG + Intergenic
1132920457 16:2387206-2387228 CAGTTGGATGTGAATGAAGCTGG + Intergenic
1133202146 16:4210223-4210245 GAGATGTAGGTGAAGGAGTCAGG - Intronic
1133528355 16:6628404-6628426 CAGATGTATATGTATGAGGCTGG + Intronic
1135565486 16:23508499-23508521 AAGATGGAGGAGAATGAGGAAGG - Intronic
1136053612 16:27671656-27671678 CAGTTGCAGGTGAAAGAGGAAGG - Intronic
1136094830 16:27947936-27947958 CAGAAGGAGGTGCCTGAGGCTGG + Intronic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138167328 16:54815432-54815454 CAAATGACTGTGAATTAGGCTGG + Intergenic
1138311508 16:56027412-56027434 CAGATGTAAGAGAATGAGCCTGG - Intergenic
1138447645 16:57074596-57074618 CAGCAGAAGGTGACTGAGGCTGG - Exonic
1139518449 16:67465622-67465644 CAGGTGAGGGTAAATGAGGACGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1142231815 16:88903608-88903630 CCAAAGAAGGTGAATGTGGCAGG + Intronic
1142431606 16:90031488-90031510 GAGATCAAGGTGAGTGGGGCCGG + Exonic
1143447379 17:7017456-7017478 CAGATGAAGGTCAAAGGGGTTGG - Intronic
1144067707 17:11639533-11639555 CATAAGATGATGAATGAGGCAGG - Intronic
1144332395 17:14236452-14236474 CAGTGGAAAGTGACTGAGGCTGG - Intronic
1144775534 17:17782958-17782980 AAGATGATGATAAATGAGGCCGG - Intronic
1145026936 17:19475455-19475477 CTGAGGAAGGAGAATCAGGCAGG - Intergenic
1145240005 17:21235618-21235640 CGAATGAAGATGAGTGAGGCTGG - Intergenic
1146150834 17:30469513-30469535 CACATGAAGGAAAATGATGCTGG - Exonic
1146454203 17:32996715-32996737 CTGATCAAGGTGATTGGGGCAGG - Intronic
1146675384 17:34769787-34769809 CAAATGAAGGTCACTGTGGCTGG - Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148872973 17:50669258-50669280 CACATGAAGGTGAGAGAGGCAGG + Exonic
1149468475 17:56897777-56897799 CAGAGGAAGGTGACTGGGGAAGG + Intronic
1150829026 17:68502018-68502040 TTGATGCAGGTGAATGAAGCTGG - Intergenic
1151813651 17:76460104-76460126 CTGAAGTAGGTGACTGAGGCTGG - Intronic
1153227179 18:2907824-2907846 CAGATGACCCTGAATGGGGCAGG + Intronic
1155000507 18:21681527-21681549 GAGATGGAGGGGAAGGAGGCTGG - Intronic
1156188579 18:34691778-34691800 CAGATGAAGGGGATTTAGGGAGG - Intronic
1156229690 18:35141233-35141255 AAGAGGAAGAGGAATGAGGCAGG - Exonic
1156595413 18:38542730-38542752 CACATGAAGCAGAATGAGGGAGG - Intergenic
1156629472 18:38949574-38949596 AGCATGAAGGTGAATGAGGCAGG + Intergenic
1156667886 18:39430212-39430234 CACATGTAGGAGAATTAGGCTGG + Intergenic
1157140529 18:45101510-45101532 GAGATTAAGGTAAATGAGGCTGG - Intergenic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1157714903 18:49877749-49877771 CAGGTGGAGGTGAGTGATGCAGG - Exonic
1157935615 18:51869191-51869213 CACATGAAGATGAATGAAACTGG - Intergenic
1158479763 18:57811230-57811252 AATATGAAAGTGAATGAGCCTGG - Intergenic
1159754661 18:72349496-72349518 CTGATCAAGGTCAATGAGCCAGG - Intergenic
1160213830 18:76908565-76908587 CAGATGAAGGTAAATGTTTCAGG + Exonic
1160949417 19:1658365-1658387 CAGGTGCAGGTGAAGGAGCCTGG - Intergenic
1161771740 19:6234434-6234456 CAGATAAAGGGGAACGAGGTGGG + Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162131177 19:8526997-8527019 CAGATGAAGGTGGCTGAAGGTGG + Intronic
1162371499 19:10282733-10282755 CAGGTGAAAGTAAATGAGCCTGG - Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162662495 19:12181333-12181355 CAGATCAAGGAGAGTTAGGCCGG - Intronic
1163093028 19:15034547-15034569 AAGATGGTGGTGGATGAGGCTGG + Intergenic
1163292076 19:16385431-16385453 CTGATGACCGTGAATGATGCTGG - Intronic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164521193 19:28981635-28981657 GGGAGGAAGGTGAAGGAGGCGGG + Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1164973023 19:32548755-32548777 AAGAAAAAGGTGAATGTGGCCGG + Intergenic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166110729 19:40621541-40621563 CATGTGAAGGTGATTGAAGCGGG + Intronic
1166664946 19:44673837-44673859 CAGAAGAAGGTGATTGAGGGAGG + Intronic
1166702333 19:44889267-44889289 GACATGAAGGGGAATGAGGAAGG + Intergenic
1166818248 19:45560173-45560195 CAGATGAAAGGGAGTGAGTCTGG - Intronic
1168051035 19:53830153-53830175 CTGATGAAAGTGACTGTGGCTGG - Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925727171 2:6884352-6884374 CAGATGCAGGTGAATTAGGAAGG + Intronic
925999717 2:9320793-9320815 CAGATGAATCTGAAGGAGACAGG - Intronic
927840881 2:26442771-26442793 GAGATGCAGGGGAGTGAGGCTGG - Intronic
928003387 2:27541294-27541316 CTGATGCAGGAGAATCAGGCAGG + Intronic
928118368 2:28564248-28564270 AATAAGAAGGTGAATGAAGCTGG + Intronic
928140993 2:28728841-28728863 CACATGACATTGAATGAGGCCGG - Intergenic
928758052 2:34549089-34549111 CAAATGGAGGTGAATCAGGAAGG - Intergenic
928833016 2:35511651-35511673 CTGGTGAAGGTTAAGGAGGCAGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
930327073 2:49933427-49933449 CAGGTGAAGAGGAATGTGGCTGG - Intronic
930879800 2:56258209-56258231 AAGATGAAGAAGAATGAAGCTGG + Intronic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
933043100 2:77494795-77494817 GAGATGAAGGAGATTGATGCAGG - Intronic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
935104350 2:100025843-100025865 CAGATGTAGGAGAATGAAACTGG + Intronic
936951122 2:117978648-117978670 CACTTAAAGGTGTATGAGGCTGG - Intronic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
937484652 2:122302040-122302062 CATATGAAGCTGAATTTGGCTGG - Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
939230252 2:139415102-139415124 CACATGTAGGAGAATGAAGCTGG - Intergenic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940607142 2:155940329-155940351 CATATGCAGGTGATTGAAGCTGG - Intergenic
941597605 2:167497220-167497242 CAGAGGAAGGGAAATGAGGGGGG + Intergenic
943309037 2:186304070-186304092 GAGGTGATGGTGGATGAGGCTGG - Intergenic
943570289 2:189565603-189565625 GAGAGGCAGGTGAAAGAGGCAGG + Intronic
943734312 2:191337217-191337239 TAGCGGAAGGTGAATGAGGAAGG - Intronic
943909689 2:193547300-193547322 CACATGAAGGAGAATGAATCTGG + Intergenic
944934405 2:204552695-204552717 CACATGTAGGAGAATGAAGCTGG - Intronic
945511013 2:210702726-210702748 AAGATGAGGGAGACTGAGGCAGG + Intergenic
947308808 2:228777825-228777847 CAGAAAAAGTTGAATGAGGGAGG + Intergenic
947504258 2:230694809-230694831 CAGACGAAGGTAAAAGAGGGAGG + Intergenic
948486318 2:238283544-238283566 CTGAGGAAGGTGCACGAGGCTGG + Intronic
1168945492 20:1752315-1752337 CACATGTAGGGGAATGAGACTGG + Intergenic
1169030562 20:2403598-2403620 CGGATGGCGGTGACTGAGGCTGG - Exonic
1170500278 20:16968504-16968526 CAGATGCAGGTGAGTGAGGCAGG - Intergenic
1171796345 20:29569444-29569466 GACATGAAGTTGAATAAGGCAGG + Intergenic
1171851893 20:30314724-30314746 GACATGAAGTTGAATAAGGCAGG - Intergenic
1172342121 20:34166709-34166731 CAGATTAAGCTGGATGAGGCTGG - Intergenic
1172748858 20:37235382-37235404 CTGATGAGGGTGACTGGGGCAGG + Intronic
1172952026 20:38728479-38728501 CAGGCGCAGGTGAAAGAGGCTGG - Exonic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1175145606 20:56893815-56893837 GGGATGAAGGTGAATGAAGGTGG - Intergenic
1175243419 20:57566622-57566644 CAGATGGGGAGGAATGAGGCAGG + Exonic
1175306750 20:57981485-57981507 CAGGGCAAGGTGAGTGAGGCGGG + Intergenic
1176066271 20:63197771-63197793 CAGATGAGGGTGGATGTGCCTGG - Intronic
1176837596 21:13808064-13808086 CAAATGAGGGTCAATGAGGTTGG + Intergenic
1177503130 21:21984788-21984810 CACATGAAGGTGAATGAAACTGG + Intergenic
1177888075 21:26770488-26770510 GAAATGAAGGTCAATGAGACAGG + Intergenic
1177944394 21:27449160-27449182 CAGATGAACGTCAATTGGGCCGG - Intergenic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178420756 21:32441500-32441522 AAGATGAGGTTGGATGAGGCTGG + Intronic
1178606147 21:34037666-34037688 CAGATGCCGGTGACTCAGGCTGG + Intergenic
1179294869 21:40052795-40052817 CACTTGAAGGTGAGCGAGGCAGG + Intronic
1182025512 22:27115066-27115088 AAGATGAAGGTGGAAGGGGCAGG + Intergenic
1183745828 22:39691173-39691195 AAGATGAGGGTGAGTGGGGCGGG - Intergenic
1183981867 22:41545426-41545448 CACGTGAAGATGAATGAGACTGG - Intergenic
1184568487 22:45307950-45307972 CAGATGGTGCTGAATGTGGCTGG + Intergenic
1185006033 22:48277460-48277482 CAGAAGAAGGTGGGAGAGGCTGG + Intergenic
1185149448 22:49155631-49155653 AAGATGAAAGGGAATGAGGGAGG + Intergenic
1185334042 22:50263607-50263629 CAGCTGGAGGTGAGTGATGCAGG + Intergenic
949871075 3:8589649-8589671 CAGATGAGGGAAACTGAGGCTGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952214600 3:31265236-31265258 CTAATGAAGGTTAAAGAGGCTGG - Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
953371496 3:42392365-42392387 CAGCTAAAGGTGAATGAAGAAGG + Intergenic
953413069 3:42701098-42701120 TAAATGAAGGTGAGGGAGGCAGG - Intronic
953724419 3:45385303-45385325 CAGTTGAAGATGAAAAAGGCAGG - Intergenic
953969119 3:47333309-47333331 CAAATGCAGGTGAGTGAGGGTGG + Exonic
953997263 3:47529591-47529613 AAAATGAAGGTGAAATAGGCTGG + Intergenic
954273509 3:49527408-49527430 CAGCTACAGGAGAATGAGGCAGG + Intronic
957825886 3:85443412-85443434 CAGAGAAATGGGAATGAGGCTGG - Intronic
958789817 3:98638924-98638946 CATATGTAGAAGAATGAGGCTGG - Intergenic
958947352 3:100378565-100378587 GATATGAAGGTGAATAAGACAGG - Intronic
959765660 3:110024304-110024326 CACATGTAGGAGAATGAAGCTGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960119327 3:113931224-113931246 CAGAGGATGGTGATAGAGGCAGG + Intronic
960463169 3:117961877-117961899 CAGATGAAGGTGATGGTGGCAGG - Intergenic
961264247 3:125628169-125628191 CACATGTAGGAGAATGAAGCTGG - Intergenic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961640967 3:128364647-128364669 CAGCAGTAGATGAATGAGGCTGG - Intronic
962420756 3:135226613-135226635 CAAAAGTAGGTGAATGGGGCTGG - Intronic
963730186 3:148963675-148963697 CAGTTGAAGATGCAAGAGGCTGG - Intergenic
964435196 3:156643919-156643941 CAGAGGCAGGGGAATGAGGAAGG - Intergenic
964589461 3:158343978-158344000 CAAAAAAAGATGAATGAGGCTGG + Intronic
964668663 3:159201744-159201766 CTGAGGCAGGTGAATGAGGCAGG - Intronic
965727909 3:171739056-171739078 AACGTGAAGGTGAATAAGGCAGG + Intronic
965919257 3:173892759-173892781 CAGAGGAAGCTGACTGAAGCAGG + Intronic
967105976 3:186255400-186255422 TATAAGAAGGTGACTGAGGCTGG + Intronic
969401305 4:6957422-6957444 CAGATGGAGGTGAAAGTTGCTGG + Intronic
969988041 4:11231810-11231832 CTGATAAAGATGAATGGGGCTGG - Intergenic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970433874 4:16014339-16014361 CAGATGAATGTCAAGGAGTCAGG - Intronic
974243908 4:59289195-59289217 CAGATGAACATGAATGAGGAAGG - Intergenic
974752885 4:66164575-66164597 CAGTTTAAGGTCAATGAAGCAGG + Intergenic
974967337 4:68777361-68777383 CAATTGATGGTGAATGAGTCTGG + Intergenic
975504728 4:75125242-75125264 CAGATGATGGTGGCTGGGGCTGG - Intergenic
976505503 4:85841710-85841732 CAGGTGTACTTGAATGAGGCTGG - Intronic
977279802 4:95025441-95025463 CAGATGATGGTGACTTGGGCTGG + Intronic
977351688 4:95896600-95896622 AAGATGAAGCTGAATCAGACAGG + Intergenic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
978560788 4:110031534-110031556 TGGAGGAAGGTGAATAAGGCTGG + Intergenic
979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG + Exonic
980238240 4:130136461-130136483 CAGATGTAGGAGAATGAAACTGG + Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
981761807 4:148202779-148202801 CAGAGGAAGGGGGATGAGGGGGG - Intronic
983145158 4:164204796-164204818 CTGATGAAGCTGAATAAGGCTGG - Intronic
984501728 4:180566239-180566261 CAGATGAATGTGAATGTGTGAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985240180 4:187922833-187922855 AAAATGAATGGGAATGAGGCAGG + Intergenic
985273838 4:188219021-188219043 CAGAAGAAGGTGCAAGCGGCTGG - Intergenic
985423149 4:189804115-189804137 CACAGGAAGGTACATGAGGCAGG + Intergenic
986202300 5:5589571-5589593 CAGATGAAGGTGATTAAGTGTGG + Intergenic
986393271 5:7304275-7304297 CAAAGGAAGGTGACTGAGGGTGG + Intergenic
988025105 5:25675677-25675699 CAGATGTAGGTGAATGACTGGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990372974 5:55139714-55139736 CTGATGAAACTGAATGAGGCAGG + Intronic
990636879 5:57738108-57738130 CTGATGAAGGTGAATAAATCAGG + Intergenic
992251399 5:74879381-74879403 CATATGAAAGTGAATCAGGCTGG - Intergenic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
995340990 5:111059373-111059395 CAGTTGCAGGAGGATGAGGCAGG - Intergenic
995802014 5:116007353-116007375 CCGATGAAGCTAACTGAGGCAGG - Intronic
997199454 5:132000969-132000991 CAGATGAGGGTCGCTGAGGCAGG - Intronic
997241670 5:132312424-132312446 CAGGTGAAGGGGACTGAGGGCGG - Intronic
997299176 5:132789857-132789879 CAGCTGAATGTGAAGGGGGCTGG - Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998005943 5:138657099-138657121 GAGGGGAAGGTGAATGTGGCTGG + Intronic
998251991 5:140559656-140559678 CAGGTGAAGGGGAGTGGGGCAGG - Intronic
1000017038 5:157287215-157287237 CAGATGATTCTGACTGAGGCAGG - Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000202875 5:159028890-159028912 CAGAAGAAGGCCAGTGAGGCTGG + Intronic
1000401074 5:160827767-160827789 CATATGCAGGTGAATGAAACTGG - Intronic
1000598868 5:163248297-163248319 CAGAAGAAGGTGGAAGAAGCTGG + Intergenic
1000886493 5:166753569-166753591 TAGAAGAATGTTAATGAGGCCGG - Intergenic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1003286597 6:4739655-4739677 CATAAAAAGGTGATTGAGGCCGG + Intronic
1004918840 6:20357323-20357345 CAGATGAAGGTGTATGCTGTGGG + Intergenic
1004922878 6:20393673-20393695 CAGTTGAATGTGAATGAAGAGGG + Intergenic
1005080422 6:21951786-21951808 GAAATGAAGGTTAATGAGGCCGG + Intergenic
1006352840 6:33533754-33533776 CCTATGAAGGAGAATGAGGTGGG + Intergenic
1007302461 6:40877608-40877630 AAGGTGAAGGTGGAGGAGGCAGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007496566 6:42263734-42263756 CAGCTGATGGTGGAAGAGGCTGG + Intronic
1007659808 6:43477197-43477219 CTGATGAAGGTGGAAGAGCCTGG + Intergenic
1008541681 6:52551490-52551512 CAGGGGAGGGTGAATGAGGGAGG + Intronic
1008883893 6:56410953-56410975 CATATGCAGCTGAATGTGGCTGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010750599 6:79612911-79612933 CAGATGCATGTGAATGAGATTGG - Intergenic
1010832404 6:80546918-80546940 CAGATGAAGGTAACAGAGGTGGG + Intergenic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1011207965 6:84921911-84921933 CAGCTAAAAGTGAATGATGCTGG + Intergenic
1011247972 6:85340085-85340107 CAGAAGCAGGTGACTGAGGCTGG - Intergenic
1011384228 6:86777057-86777079 CTGATCAATGTGAATGAGACTGG - Intergenic
1011666436 6:89638975-89638997 CAAATGAAAGTGAAGGAGGCCGG + Intergenic
1012188484 6:96251790-96251812 CAGCTGAGGGTGAATGAAGTAGG + Intergenic
1012599698 6:101079867-101079889 CAGATGAGGGTGAAGGAGAGTGG - Intergenic
1012726571 6:102819990-102820012 CATATGTAGGTAGATGAGGCAGG - Intergenic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1016273454 6:142318981-142319003 CAGATGAAGATGAATGCTGAAGG + Intronic
1016288154 6:142496911-142496933 CAGATGGGACTGAATGAGGCTGG + Intergenic
1016585779 6:145683114-145683136 CATGTGAAGGTGAATTATGCTGG + Intronic
1016772540 6:147868160-147868182 CAGATGAAGGTAAATGTGCAGGG + Intergenic
1018010060 6:159661377-159661399 CACATGAAGGAGAATGAAACTGG + Intergenic
1018970524 6:168525721-168525743 CATGTGAAGGTGGAAGAGGCAGG + Intronic
1023450758 7:40282537-40282559 CAGATGCAGAAGAATGAGGTTGG + Intronic
1023544387 7:41302408-41302430 CACATGTAGGAGAATGAGACTGG + Intergenic
1027375884 7:77549020-77549042 GAGATAAAAGTGAATGAGACAGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028503890 7:91550224-91550246 AAGATGAAGGGGAATCAGGGTGG - Intergenic
1028623038 7:92845549-92845571 CCCTTGAAGGTGAAGGAGGCTGG - Intergenic
1028847706 7:95500757-95500779 CAGTTGAAGATGTATGAGACAGG - Intronic
1029661227 7:101963378-101963400 CATGTGATGTTGAATGAGGCAGG + Intronic
1030725556 7:112922052-112922074 CTGATGCAGGAGAATCAGGCAGG - Intronic
1031844665 7:126790765-126790787 CAAGTGAAGGTGAATGAGGAAGG + Intronic
1031851551 7:126870444-126870466 AAGATGAAGCTTAATGAGGAAGG - Intronic
1031956051 7:127943715-127943737 CAGATGAAGGTGCATTTGGATGG + Intronic
1033824099 7:145168645-145168667 CAGATCCTGGTGAACGAGGCGGG - Intergenic
1033986086 7:147227263-147227285 AAGATGAAGTTGAATAGGGCTGG + Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1036131905 8:6123282-6123304 CAGAAGAAGGTGGAAGAAGCAGG - Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036487423 8:9192123-9192145 CAGGTCTATGTGAATGAGGCAGG - Intergenic
1036548204 8:9792430-9792452 CAGCTGAAGGAGGCTGAGGCAGG + Intergenic
1040684978 8:49860967-49860989 CAGATGAAGCTGAAAGATGCTGG + Intergenic
1041112350 8:54495746-54495768 CACATGAAGGAGAATGAAACTGG - Intergenic
1041154395 8:54970132-54970154 AAGATGAAGGTGAAATTGGCAGG - Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041886708 8:62817431-62817453 CAGAAGAAGGTGAATCTGGGAGG - Intronic
1042982785 8:74549161-74549183 CAGATCAAGGTGAAAGGGGTGGG + Intergenic
1043232736 8:77823167-77823189 CAAATAAAGTTGAATCAGGCTGG - Intergenic
1044121671 8:88404484-88404506 TAGATTAAGGTTAATGAGGGAGG - Intergenic
1045021122 8:98045333-98045355 AAGAAGACGGTGAGTGAGGCGGG - Exonic
1046261234 8:111771140-111771162 TTGATCAAGGAGAATGAGGCAGG - Intergenic
1046714910 8:117557005-117557027 GAGATCAATGTGAAGGAGGCAGG + Intergenic
1046755575 8:117969824-117969846 CAGATGAATGTGAATCAGAACGG + Intronic
1047181126 8:122589149-122589171 CAGAAGACAGTGAATGTGGCTGG - Intergenic
1047347186 8:124039741-124039763 CAGAGGAGGGTGGATGTGGCTGG + Intronic
1048851594 8:138650528-138650550 AAGAGGCAGGTGGATGAGGCAGG - Intronic
1049369128 8:142255112-142255134 CGGCTGAAGGGGAGTGAGGCAGG + Intronic
1051318138 9:15866100-15866122 GAGATAAAGCTCAATGAGGCAGG + Intronic
1051413206 9:16812057-16812079 CAGCTGCAGGGGAATGAAGCAGG + Intronic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053789678 9:41677978-41678000 GACATGAAGTTGAATAAGGCAGG - Intergenic
1054155466 9:61636775-61636797 GACATGAAGTTGAATAAGGCAGG + Intergenic
1054178016 9:61889669-61889691 GACATGAAGTTGAATAAGGCAGG - Intergenic
1054475251 9:65567885-65567907 GACATGAAGTTGAATAAGGCAGG + Intergenic
1054659513 9:67691155-67691177 GACATGAAGTTGAATAAGGCAGG + Intergenic
1054704841 9:68452080-68452102 GAGATAAAGGTGAATGGAGCAGG - Intronic
1054912666 9:70468136-70468158 CTCAGGAAGCTGAATGAGGCAGG + Intergenic
1055252114 9:74320389-74320411 CACAAAAATGTGAATGAGGCTGG + Intergenic
1055980179 9:81993303-81993325 GAGATGAAGGTGGCTGAGGAGGG - Exonic
1056739976 9:89246082-89246104 CATAAGAAGGCAAATGAGGCTGG + Intergenic
1057132787 9:92666344-92666366 AAGCTGAAGGCGAAGGAGGCAGG + Intronic
1059028875 9:110667903-110667925 TAAAGGAAGCTGAATGAGGCTGG + Intergenic
1059490015 9:114659146-114659168 GAGATGCTGGTGACTGAGGCTGG - Intergenic
1061064027 9:128266340-128266362 CAAAGGAAGGTGACTGAGGGTGG + Intronic
1062039820 9:134399169-134399191 CAGCTGAAGGTGGGTGAGGTGGG + Intronic
1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG + Intergenic
1185526557 X:784874-784896 CAGAGGAAGCTGAATGGGTCAGG - Intergenic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187240201 X:17506016-17506038 CAGATGAGGAAGAATGATGCTGG - Intronic
1187641883 X:21300300-21300322 CAGGTGAATGTGAATGAGAAAGG + Intergenic
1187773139 X:22724588-22724610 CACATGTAGGAGAATGAAGCTGG + Intergenic
1190120655 X:47656723-47656745 CATGTGAAGGTGAGTGTGGCAGG + Intronic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190517863 X:51243492-51243514 CTGATGATGGTGGATGGGGCTGG + Intergenic
1191690363 X:63932880-63932902 GAGATGAAGGGGCAAGAGGCTGG - Intergenic
1193208295 X:78775092-78775114 CACATGTAGGTGAATGAAACTGG - Intergenic
1194956033 X:100181620-100181642 CACATGTAGGAGAATGAAGCTGG + Intergenic
1195647535 X:107249627-107249649 CAGGTGCAGGTGTAAGAGGCTGG - Intergenic
1196433325 X:115651580-115651602 AAGATGAACGTGAATGAGTATGG - Intergenic
1196598146 X:117568988-117569010 AAGATGATGGTGAGAGAGGCAGG + Intergenic
1198287337 X:135204554-135204576 CAAAGGAAATTGAATGAGGCAGG - Intergenic
1198818753 X:140622402-140622424 AAGATGAAGGTGAGTGTGGCTGG + Intergenic
1199007989 X:142724696-142724718 CACATGTAGGAGAATGAAGCTGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic