ID: 1130749525

View in Genome Browser
Species Human (GRCh38)
Location 15:86695764-86695786
Sequence CTGTATCTCAGAGGTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 16, 3: 34, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130749522_1130749525 -4 Left 1130749522 15:86695745-86695767 CCTCTTAGCACCATCTTTGCTGT 0: 8
1: 90
2: 310
3: 505
4: 982
Right 1130749525 15:86695764-86695786 CTGTATCTCAGAGGTTTTAATGG 0: 1
1: 1
2: 16
3: 34
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130749525 Original CRISPR CTGTATCTCAGAGGTTTTAA TGG Intronic
900723456 1:4196872-4196894 CTGTATCCCAGAGGTTTACTAGG - Intergenic
903007900 1:20310563-20310585 CTGTGTCTCACAGGTTCTGAAGG + Exonic
906578800 1:46917301-46917323 CTGTATCTTAGGGGTTTGATAGG + Intergenic
909174757 1:72343017-72343039 CTTTATCTCAGAGCTGTAAATGG - Intergenic
909521725 1:76576160-76576182 CTGTATCTGAGAGTTTCTAGGGG - Intronic
909803195 1:79840609-79840631 CTCTCTCTCAAAAGTTTTAAAGG - Intergenic
911743506 1:101413562-101413584 CTGTATCCCAGAGGTTTTGATGG - Intergenic
912979700 1:114360283-114360305 TTCTAGTTCAGAGGTTTTAAAGG + Intergenic
915821407 1:159028184-159028206 TTGTATCTCAGAGGTTTTATAGG + Intronic
917179182 1:172275743-172275765 CTATATTTCAGATGTTTTCATGG - Intronic
917254905 1:173103851-173103873 CTGTGTCTCAGAGTTTTTATAGG + Intergenic
917577529 1:176339681-176339703 CTGAATCTCAGAGAGTTTAAGGG + Intergenic
917781574 1:178402917-178402939 CAGTCTCTCAGAGGTTATCATGG - Intronic
918750555 1:188264184-188264206 CTATATCCCAGAGGTTTTGTAGG + Intergenic
919062393 1:192649966-192649988 CAGTCTCTCAGGGGTTTGAAAGG - Intronic
920912397 1:210231395-210231417 AAGACTCTCAGAGGTTTTAAGGG - Intergenic
921513584 1:216062485-216062507 CTGTAATTCAGAGATTATAAAGG + Intronic
1062824714 10:559021-559043 AGGAATCTCAGAGGTTTTCAAGG + Intronic
1063517164 10:6708018-6708040 ATGTATCACAGAAGTGTTAAAGG + Intergenic
1064842239 10:19606653-19606675 TTGTTTCTCAGAGTGTTTAATGG - Intronic
1065476526 10:26144029-26144051 CTGTAACTTAGAGGTTATTAAGG - Intronic
1067671988 10:48332033-48332055 CTTTATCTCAAGGGTGTTAAGGG - Intronic
1067899999 10:50230060-50230082 CTGAGTCTCAGAGAGTTTAATGG + Intronic
1069038045 10:63665845-63665867 CTGAATCTAAGACGTTTGAAGGG - Intergenic
1069245231 10:66196488-66196510 CTGTATATCAGAGGAAGTAAAGG + Intronic
1070939719 10:80333895-80333917 CTGTATCTCAGAGTCTTAGAGGG - Intergenic
1071511629 10:86265973-86265995 CTGGATCTCAGAGGGCTGAAGGG - Intronic
1071795581 10:89001771-89001793 CTGTTTCTGAGAGGTTCAAAGGG + Intronic
1073550226 10:104393240-104393262 ATATATTTCAGAGCTTTTAAGGG - Intronic
1073834909 10:107430090-107430112 CTGAAGCTCAGAGACTTTAAGGG - Intergenic
1077731045 11:4730211-4730233 CTGGAACTCAGAGGTTTCACTGG - Intronic
1078757056 11:14221251-14221273 CTGTATCTCAGACATTATAATGG + Intronic
1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG + Intergenic
1079722132 11:23828999-23829021 CAGTATCTGAGATTTTTTAATGG - Intergenic
1079753933 11:24232309-24232331 CTGCATCCCAGAGATTTTGATGG + Intergenic
1081195502 11:40155179-40155201 CTGTATCCCAGAGTTTTGATAGG - Intronic
1081305914 11:41512024-41512046 CTTCATTTTAGAGGTTTTAAGGG - Intergenic
1085491774 11:76926254-76926276 CTGTATCTCTGAGGTTCTTCCGG + Intronic
1085984354 11:81767532-81767554 CTGAGTCTCAGAGATGTTAAAGG + Intergenic
1087690281 11:101313220-101313242 CTGTATCCCAGAGATTTTGTAGG + Intergenic
1088227799 11:107640884-107640906 CTATAATTCACAGGTTTTAAGGG - Intronic
1088684480 11:112273568-112273590 TAGTATCTTTGAGGTTTTAAAGG - Intergenic
1088877968 11:113951622-113951644 CTGTGTCACAGTGGTTTAAAAGG - Intergenic
1090113371 11:123940192-123940214 CTTTGTCTTAGAGCTTTTAATGG + Exonic
1093277224 12:17144572-17144594 CTGTCTCTTTGAGGTTTTCATGG + Intergenic
1094080673 12:26531568-26531590 ATGTATCTCAGATTTTTAAAAGG + Intronic
1095129582 12:38523302-38523324 CTGGTTCCCAGAGGTTTTCATGG - Intergenic
1096044057 12:48546302-48546324 CTGGATCTCAGTCTTTTTAATGG - Intergenic
1099389072 12:82056050-82056072 CTGTAGCTCAGAGCCTTCAAAGG - Intergenic
1099751984 12:86786716-86786738 CTCTATCTTTGAAGTTTTAAAGG + Intronic
1100683121 12:96951663-96951685 AAGTATCTCAGAGGTTAAAAAGG - Intronic
1100828026 12:98492931-98492953 GTGTCCCTCAGAGGTTTTCAGGG - Intronic
1100937205 12:99682576-99682598 CTGTATCCCAGAGGTTTGATAGG - Intronic
1101368789 12:104104347-104104369 CTGTATCTTTAAGGTTGTAATGG - Exonic
1101456935 12:104842708-104842730 CTTTAGATCAGAGGTTTAAAAGG + Intronic
1102229983 12:111255958-111255980 CTGTATCTGTGAGGCTGTAAAGG - Intronic
1104402659 12:128489407-128489429 CTGTAGCACAGAGCGTTTAAGGG + Intronic
1105466550 13:20647493-20647515 CTGTATCTCTTAGATTTTTATGG + Intronic
1106067336 13:26367778-26367800 CTGGATCTGAGATGTTTTGAAGG - Intronic
1106863109 13:33933037-33933059 CAGTATCTCAGATTTTTCAAAGG - Intronic
1107794971 13:44041986-44042008 CTGAGTCTCAGGAGTTTTAAGGG - Intergenic
1108981478 13:56521309-56521331 CTGCATGTCAGAGGTCTTCAAGG + Intergenic
1109536000 13:63720493-63720515 ATATTTCTCAAAGGTTTTAATGG - Intergenic
1109540100 13:63765793-63765815 ATATTTCTCAAAGGTTTTAATGG + Intergenic
1109589315 13:64456982-64457004 ATTTATTTCAGAGGTTTTAAGGG + Intergenic
1109852710 13:68088007-68088029 ATGGATCTCAGAGGTCTTCAGGG + Intergenic
1112171309 13:96975585-96975607 ATGCATTTCAGAGGTTTTAGAGG - Intergenic
1113371162 13:109726783-109726805 CTGTGTTGAAGAGGTTTTAATGG - Intergenic
1113555692 13:111232215-111232237 CTGTCTCTCAATGGTTTTATGGG - Intronic
1115543723 14:34446253-34446275 CTTTATCTCAAAGGTTCCAATGG - Intronic
1115750008 14:36479818-36479840 CTGGATCTCAGAGGTTAAAGTGG - Intronic
1116071639 14:40054029-40054051 CTGAATCTCAGAGGCCTTTATGG + Intergenic
1116347000 14:43806463-43806485 CTGTATCCTAGAGGTTTTGATGG - Intergenic
1116890637 14:50264567-50264589 GTGTTTCTAACAGGTTTTAATGG + Intronic
1117289352 14:54317460-54317482 CTGTATCTTTGAGGTTTTCAGGG - Intergenic
1120736111 14:88054918-88054940 CTGTATCCCCGAGGTTTGATAGG + Intergenic
1120778565 14:88464428-88464450 CTGTAAGTCAGACTTTTTAAAGG - Intronic
1120785518 14:88531256-88531278 CCATATCCCAGAGGTTTTATAGG - Intronic
1123207826 14:106730516-106730538 CTGTAACACAGAGGTGTTAGTGG - Intergenic
1124557382 15:30738948-30738970 CTGTATCCCAGAGGTTTGACAGG - Intronic
1124589661 15:31041772-31041794 CTGTCTCTCAGAGGTGTTTTTGG - Intronic
1124673875 15:31666800-31666822 CTGTATCCCAGAGGTTTGATAGG + Intronic
1126577786 15:50213781-50213803 TTGTATCCCAGAGGTTTTGATGG - Intronic
1127185406 15:56474240-56474262 CTGTATGTCAGAGATATTATTGG - Intergenic
1129367703 15:75066865-75066887 CTTTACCTCAAAGGTGTTAAGGG + Intronic
1130174897 15:81558349-81558371 CTGTTTCTCAGAGGTTTTGTAGG + Intergenic
1130645084 15:85718278-85718300 CTGTACCTTAAAGTTTTTAAAGG - Intronic
1130749525 15:86695764-86695786 CTGTATCTCAGAGGTTTTAATGG + Intronic
1130824273 15:87527826-87527848 CTATATCTCACAGTTTTTATGGG + Intergenic
1131405495 15:92160929-92160951 CTGTATCTCAGGGGGTTCATAGG - Intronic
1133139905 16:3736030-3736052 CTGTACCTCAGTGGTTTCACTGG + Exonic
1133644313 16:7749000-7749022 CTTTAAATCAGAGGTTTTCATGG - Intergenic
1133952895 16:10412346-10412368 CTATATCCCAGAAGTTTTATAGG + Intronic
1135005365 16:18817169-18817191 CTGTATGTAAGAGGTTGTTAGGG - Intronic
1137292103 16:47058748-47058770 CTGCAGCTCAGGGGTTTTTATGG + Intergenic
1146269519 17:31475505-31475527 CTGTGTCACAGGGGTTTTGAGGG - Intronic
1148468464 17:47878686-47878708 CTGAATCTCTGGGGCTTTAAAGG - Intergenic
1151474093 17:74335739-74335761 CTGTCTCTGGGAGGTTTCAATGG - Intronic
1151996568 17:77613075-77613097 CTGATGCTCAGAGGTTTTACTGG + Intergenic
1153543167 18:6178952-6178974 CTGTGTCTCACAGATTTTAAAGG + Intronic
1155891914 18:31280583-31280605 ATGTAGCTAAGAGGTTTTCACGG - Intergenic
1156650375 18:39218852-39218874 CTTGATCCCTGAGGTTTTAATGG + Intergenic
1157974600 18:52312804-52312826 TTGCATCCCAGAGTTTTTAAGGG + Intergenic
1159906842 18:74100385-74100407 CTGTATCCTAGAGGTTTGATAGG - Intronic
1160147610 18:76377658-76377680 CTGGATCTCAGATGTTCTAATGG + Intronic
1165302463 19:34979427-34979449 GTGGATCGCACAGGTTTTAAGGG + Intergenic
1166413460 19:42573581-42573603 CTGTAGCTCAGTGGTTCCAAAGG + Intergenic
1166603997 19:44124183-44124205 CTGTATCCCAGAGGTTTTCATGG + Intronic
928988719 2:37207621-37207643 CTGTATCCCAGAGGTTTTGATGG - Intronic
930532715 2:52610519-52610541 CTGTATCTCAGAGATTTTACAGG + Intergenic
930751538 2:54939325-54939347 CTGCATCTCAGTGGTGTTGAGGG + Intronic
931167769 2:59767929-59767951 CATTATCTTAAAGGTTTTAAGGG - Intergenic
931536057 2:63278232-63278254 CTGTATCCCAGAGATTTTGATGG - Intronic
932524096 2:72444858-72444880 GGGTATGTCAGAGGTTTTCATGG - Intronic
933115538 2:78465345-78465367 CTGAATCTCACAGCTATTAAGGG + Intergenic
933386421 2:81617141-81617163 CAGCATCTCAGACTTTTTAAAGG + Intergenic
934575216 2:95395964-95395986 CTGTATCTCAGAGGATGTCATGG - Intergenic
934591745 2:95558632-95558654 CTGTATCTCAGTGGGTTTAGTGG - Intergenic
935409679 2:102747914-102747936 TTATATCACTGAGGTTTTAAGGG - Intronic
938175347 2:129121518-129121540 CTGTATCCCAGAAGTTTTGATGG + Intergenic
938853770 2:135289096-135289118 CTGTATCCTAGAGGTTTTGATGG + Intronic
939263403 2:139839268-139839290 TTGTATCTCATGGATTTTAAAGG - Intergenic
939433391 2:142141182-142141204 CTGTAACCCAGAAGTTTGAAAGG + Intergenic
939924662 2:148158380-148158402 CCTTGTCTCAGAGGTTTAAATGG + Intronic
940482933 2:154258359-154258381 CTGTTATTCAGAGGTTTGAAAGG - Intronic
940844656 2:158626720-158626742 CTGTACCTCATTGTTTTTAAGGG + Intronic
941407934 2:165115144-165115166 CTGTATCTTAGAGCTTTTGCAGG - Intronic
942113842 2:172708043-172708065 CTGTATCTCAGCAGTTTTAGAGG + Intergenic
942647896 2:178134526-178134548 CATTAGCTCAGAGTTTTTAAGGG + Intronic
943133054 2:183879682-183879704 CTGTATCCCAGAGGTTTGGATGG - Intergenic
943230654 2:185246065-185246087 CTGGAACTCAGAGGATTTACTGG + Intergenic
943497576 2:188642360-188642382 GTGTATCTCAAAAGTTTTAATGG - Intergenic
943943741 2:194031792-194031814 CTGTATCTTAGAGGTGTGATAGG - Intergenic
943953372 2:194157875-194157897 CTTTATCTCAAGGGTGTTAAGGG - Intergenic
945206463 2:207337896-207337918 CTGTGACTCAGAGGTTTAACTGG + Intergenic
945928130 2:215827233-215827255 GTGTATCTCAGACATTTGAAAGG - Intergenic
1170180842 20:13528283-13528305 CAGTATTTGCGAGGTTTTAAGGG - Intronic
1170927958 20:20742963-20742985 CAGCATCTCAGAGATTTCAAAGG + Intergenic
1173176322 20:40767495-40767517 ATGGAACTGAGAGGTTTTAACGG + Intergenic
1175075526 20:56369464-56369486 ATGTGTCTCAGAGCTGTTAAGGG - Exonic
1175936294 20:62515637-62515659 CTGCATCTCAGAGGCTCTGAGGG + Intergenic
1176885723 21:14253223-14253245 ATGTATCTCAGAGGTGACAATGG + Intergenic
1178073079 21:28990905-28990927 CTGAATCTCAGATGTTAAAACGG + Intronic
1179274393 21:39878753-39878775 TTGTATCTCAGAGCTTCTAGTGG + Intronic
1183880093 22:40819588-40819610 CTCCATCTCAGAAGTCTTAATGG + Intergenic
950943734 3:16922858-16922880 CTGTTTCTCCAAGGTATTAATGG - Intronic
951657943 3:25030019-25030041 CTGTCTCTCAGAGGAATAAAGGG - Intergenic
953507779 3:43503285-43503307 CAGTATCTGAGAGTATTTAAAGG - Intronic
955125803 3:56110980-56111002 CTGTCTCCCAGATGTTTTCAAGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956961800 3:74411502-74411524 TTATTTCTCAGAGCTTTTAATGG - Intronic
957567923 3:81908402-81908424 ATGTAAATCAGAGGTTTTATGGG + Intergenic
958872128 3:99572388-99572410 CTGCATCTTATAAGTTTTAACGG + Intergenic
959899309 3:111641968-111641990 CTGTATCCCAGAGGTTCGATAGG - Intronic
960996304 3:123342710-123342732 CTGGAGCCCTGAGGTTTTAAAGG - Intronic
962199571 3:133390318-133390340 CATTACCTCAGAGGTTTCAAGGG - Exonic
962983778 3:140515537-140515559 CTGTATCCAAGAGGTTTCGATGG + Intronic
965441952 3:168725196-168725218 CTGTATATCGGATGTCTTAAGGG - Intergenic
965918533 3:173881845-173881867 ATGAATCACAGATGTTTTAATGG + Intronic
967602677 3:191408024-191408046 CTTTATCTCATTGGTTTTAGAGG + Intergenic
970457193 4:16236624-16236646 CTGTAGCCCAGAAGTGTTAATGG + Intergenic
971472027 4:27037450-27037472 CTATATCCCAGAGGTTATGATGG + Intergenic
972509774 4:39757720-39757742 CTGAATCTTAGAGCTTTTAGAGG - Intronic
972561386 4:40231945-40231967 CTCAAGCTCAGTGGTTTTAAGGG + Intronic
972999360 4:44926693-44926715 ATGTATCTCAGAGGGTACAATGG + Intergenic
973091301 4:46140545-46140567 TTGTATCTCAGTAGTTTTTAGGG + Intergenic
974583455 4:63837092-63837114 CTGTATCACACAGGTCTTCAGGG + Intergenic
974722012 4:65752507-65752529 CTGAAGCTCAGAGCTTCTAATGG + Intergenic
975331116 4:73114690-73114712 CTATATATCACAGGTTTTTAGGG - Intronic
975534825 4:75438388-75438410 CTGTATCCCAGAGGTTTTGATGG - Intergenic
975543256 4:75535943-75535965 CTGTATCTGAGAGATGTTAAGGG - Intronic
976382690 4:84418238-84418260 CTGTTTGCCAGAGGTCTTAAGGG + Intergenic
976444757 4:85117788-85117810 GGGTATGTCAGAGGTTTTCAGGG + Intergenic
977658258 4:99549890-99549912 CTATATATCAAAGGTTTTAGAGG + Intronic
977906828 4:102486420-102486442 CTGTATCCCAGAGGTTTTAACGG - Intergenic
978537197 4:109774967-109774989 CTGTATCCCAGAGGTTTTGGTGG + Intronic
978757695 4:112321516-112321538 CTGTATCCCAGAGGTTTTGTAGG + Intronic
978938291 4:114405858-114405880 CTATATCTCACAGGTTTTTCTGG + Intergenic
979815626 4:125100276-125100298 CTGTGTCTCAGATATTGTAAAGG - Intergenic
980548548 4:134302822-134302844 TTTTATCTCAGTGGCTTTAAAGG + Intergenic
982451309 4:155555265-155555287 CTGTATCCCAGAGGTTTTGATGG - Intergenic
984819791 4:183871617-183871639 CTGTATCTGATATTTTTTAAGGG + Intronic
985156655 4:186996164-186996186 CTCAATCTCAGAGGTGTTTAGGG - Intergenic
986564843 5:9101815-9101837 CTGCATCTGTGAGGTTTCAAGGG + Intronic
987500700 5:18705855-18705877 CTTTTTCTCAGATGTTTGAAGGG + Intergenic
987960386 5:24799979-24800001 CTTCAGCCCAGAGGTTTTAATGG - Intergenic
988423705 5:31037872-31037894 TTGTGTCCCAGAGGTTTTGATGG - Intergenic
988572479 5:32382985-32383007 ATGTATTTCATAGATTTTAAGGG + Intronic
988932274 5:36048061-36048083 ATGTATTTCAGAGGTCCTAAGGG - Intronic
989492598 5:42075221-42075243 CTGCATCCCATAGGTTTTTATGG - Intergenic
989561933 5:42862309-42862331 CTGTATCCCAGAGGTTTTATAGG + Intronic
989799387 5:45518139-45518161 CTTTATCTTAGAGGATTTACCGG + Intronic
990435479 5:55786257-55786279 TCATATCTCATAGGTTTTAAGGG + Intronic
991911807 5:71570180-71570202 CTGGATCACAGAGGCTTTTAAGG + Intergenic
992487251 5:77209572-77209594 CTGTAACTCAGAGTTTACAAGGG + Intergenic
992898879 5:81272907-81272929 CTGTATCCCAGAGGTTTTGATGG - Intergenic
993637023 5:90357054-90357076 CTGGAGCTCAGAGTTTATAAAGG - Intergenic
993765934 5:91858667-91858689 TTCTATCTCAGAGGTATAAATGG - Intergenic
994951064 5:106463667-106463689 ATCTATCTCCGAGTTTTTAAAGG + Intergenic
995153078 5:108874074-108874096 CTGTATATCTAAGGTTGTAAGGG + Intronic
995326497 5:110894687-110894709 CTGTTTCTCAGTGGGTTTCAAGG + Intergenic
995531667 5:113097157-113097179 CTGTATCTCACAGCTTTTAATGG - Intronic
995799931 5:115983010-115983032 CTGTTTGTAAAAGGTTTTAAAGG + Intronic
996506962 5:124278166-124278188 CTGGATATCAGAGGATTAAAGGG - Intergenic
997798067 5:136831270-136831292 CTGTATCTCAGAGGTTTGATAGG + Intergenic
998744500 5:145242465-145242487 CTGTAATTCAGAGATATTAAAGG + Intergenic
999001665 5:147930315-147930337 CAGAATGTCAGAGGTTTAAAGGG - Intergenic
999473911 5:151880323-151880345 GTGTATCTCAGAAGTATTAATGG + Intronic
1000780008 5:165468312-165468334 CTGTATCCCAGAGGTTTTGATGG - Intergenic
1003890169 6:10557030-10557052 CAGTATCTGAAAGGATTTAAAGG + Intronic
1004245579 6:13972473-13972495 CTGCATATCAGAGGTCTTTATGG + Intronic
1007219642 6:40268474-40268496 CTGGATGTGAGAGGGTTTAAGGG - Intergenic
1007266444 6:40599856-40599878 CTGGATCACAGAGGTTGTGAGGG + Intergenic
1007837940 6:44690370-44690392 CTGAATCTCTGTGCTTTTAATGG + Intergenic
1008522162 6:52372523-52372545 TTGTAGATCAGAGGTTTTGAGGG - Intronic
1008720136 6:54339058-54339080 CTCAATTTCAGAGGTGTTAATGG - Intronic
1008744646 6:54655214-54655236 CTGTAGCTCAAAACTTTTAATGG + Intergenic
1010432094 6:75789390-75789412 CTGTATGTCATAGCTTTTCATGG + Intronic
1011196069 6:84780552-84780574 CTGTCTGTCATAAGTTTTAAAGG + Intergenic
1011328831 6:86181343-86181365 CCGTATCCCAGAGGTTTTGATGG + Intergenic
1013531944 6:111027641-111027663 CTGTATGTGAGACGTCTTAAGGG + Intronic
1013856952 6:114584184-114584206 CTGTATCCCAGATGTTTTAATGG - Intergenic
1013900751 6:115153662-115153684 CTGTATCCCAGAGGTTTTGAAGG + Intergenic
1015810230 6:137155029-137155051 CTGTATGTCTGAGGTTTCACTGG + Exonic
1016417577 6:143849228-143849250 CTGTATGTAAGAGATTTCAAGGG + Intronic
1017214696 6:151896851-151896873 CTGTATCCCAGAGGTTTGGATGG + Intronic
1017556075 6:155570422-155570444 CTGTATCTCAGAGGCTTGATAGG + Intergenic
1018399041 6:163404243-163404265 CTTTCTCTCAGTGGTTTTCAAGG - Intergenic
1020867058 7:13578836-13578858 CTGCATCTCAGAGGGTCTCAAGG - Intergenic
1028089977 7:86687115-86687137 ATGTATATCAGAGCTTTTCATGG - Intronic
1033031942 7:137835397-137835419 CTGTAGCTCAGTGATTTTTAGGG - Intronic
1033790482 7:144787057-144787079 CTTTATCTCTGAGGTTCTTAGGG - Intronic
1034274528 7:149818207-149818229 CAGTATCTGAGGGGTTTTGAGGG + Intergenic
1037396121 8:18445691-18445713 ATGTATCACAGAGGATTTTAGGG + Intergenic
1037694583 8:21212380-21212402 ATATATCTTAGAGGTTTGAATGG + Intergenic
1039305431 8:36256874-36256896 CTGAAGCTCAGAGATGTTAAGGG - Intergenic
1039536916 8:38324837-38324859 CTGTAGCTCAGGGATTTTTATGG - Intronic
1039642594 8:39240395-39240417 CTGTATCTCAGAGGATTGGATGG - Intronic
1039778643 8:40761852-40761874 CTGTCTCTCAGAGTTGTTAAGGG - Intronic
1041324637 8:56651693-56651715 CTATATCCCAGTGGTCTTAAAGG - Intergenic
1042022525 8:64382878-64382900 ATGTATTGCAAAGGTTTTAAGGG - Intergenic
1042188975 8:66166468-66166490 GTGTATCTCAGTGATTTTCATGG + Intronic
1043282563 8:78486306-78486328 CTGGATCTCACAGCTTTAAAGGG + Intergenic
1043985598 8:86691895-86691917 CTGTATCCAAGAGGTTTTGATGG + Intronic
1045881221 8:107043052-107043074 CTGTATCCCAGAGGTCTGATAGG + Intergenic
1046169294 8:110484486-110484508 CTGCATCTCAAAGGTCTGAAGGG + Intergenic
1046235804 8:111422999-111423021 CTGTATCCCAGAGGTTTGATAGG - Intergenic
1047747297 8:127854456-127854478 CTGTCCCTCAGAGCATTTAAAGG + Intergenic
1050428798 9:5540205-5540227 CTGTATCCCAGAGTTTTGATAGG - Intronic
1052443945 9:28534649-28534671 CAGTATCTAAGAGTTTTTAAGGG - Intronic
1056495316 9:87149606-87149628 CTGTTTTTCAGAGGTTTGAGAGG - Intronic
1057119206 9:92556058-92556080 CTATATCCCAGAGGTTTGATAGG + Intronic
1058644019 9:107113809-107113831 CTGAGGCTCAGAGGTGTTAAAGG - Intergenic
1059095987 9:111415398-111415420 GTCTATATCAGAGGTTTTTATGG - Intronic
1059760494 9:117332817-117332839 CTGTATTTCATAGCTTTTTAAGG - Intronic
1186408970 X:9329173-9329195 CTGGATTTCAGACGTTTTTAAGG + Intergenic
1186980816 X:14955524-14955546 CAGTATGTCAGAGGTTTTCATGG - Intergenic
1187626905 X:21124666-21124688 TTGTATTTCAAAGGTTCTAACGG - Intergenic
1187751952 X:22476390-22476412 CTGTATCCCAGAGGTTTTGAAGG + Intergenic
1189884780 X:45530992-45531014 CTCTAGATCAGAGGTTATAAGGG + Intergenic
1190389159 X:49914496-49914518 CTGTGTCACATAGGTTTTGATGG - Intergenic
1193450616 X:81660181-81660203 CTTTTTCCCAGAGGTTTCAAAGG + Intergenic
1193454273 X:81710843-81710865 CTTTTTCTCAGCAGTTTTAAAGG + Intergenic
1194602417 X:95938895-95938917 TTGTATCCCAGAAGTTTTGATGG + Intergenic
1194741007 X:97574254-97574276 CTGTATTTCATAGTTGTTAAAGG - Intronic
1196034818 X:111132592-111132614 CTTTATCTCAAAGGACTTAATGG + Intronic
1196477827 X:116109481-116109503 CTGTATCCCAGAGGTTTTGATGG + Intergenic
1197363813 X:125538975-125538997 CTGTATGCCGGAGGTTTTGATGG - Intergenic
1197668833 X:129253392-129253414 CTGTATCCCCAAGGTTTTGATGG + Intergenic
1199072808 X:143498286-143498308 CGGCATGTCAGAGGTTTTCATGG - Intergenic
1199411034 X:147523366-147523388 CATTATCTCAATGGTTTTAATGG - Intergenic
1199750355 X:150810416-150810438 CTGTATCTCATAAGTTTTTGTGG - Intronic
1201330264 Y:12811717-12811739 CTTTTTCTCAGAAGTTTGAAAGG - Exonic