ID: 1130751392

View in Genome Browser
Species Human (GRCh38)
Location 15:86716813-86716835
Sequence ATTGGGAATCCAAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130751392 Original CRISPR ATTGGGAATCCAAATGAGGT GGG Intronic
907020652 1:51063814-51063836 ATTGGGTATGCTAAAGAGGTGGG - Intergenic
908113484 1:60919528-60919550 ATATGAAAACCAAATGAGGTAGG - Intronic
908787312 1:67747999-67748021 AGTGGGAACCCAAAAGAGGGTGG + Intronic
909414974 1:75395878-75395900 ATTGGGGATCCAAGTAATGTTGG + Intronic
909429825 1:75574595-75574617 AGTGGAGCTCCAAATGAGGTGGG - Intronic
914335861 1:146714568-146714590 TTTTGGAATTCAAATGAGGGAGG - Intergenic
916515318 1:165511259-165511281 AGTGGCAATTCAAATGAGATTGG - Intergenic
917098435 1:171422921-171422943 CTTGGGAATCTAAAGGAGGAAGG + Intergenic
919095513 1:193030102-193030124 TTTGGGAATTTAAATGAGGGTGG - Intronic
919988490 1:202692256-202692278 ATAGGGCCTCCAAATGAGGCTGG - Intronic
921887531 1:220321707-220321729 CTTGTGAACCCAAAGGAGGTGGG + Intergenic
923967781 1:239161301-239161323 AGTGTGAATGCAAATGATGTAGG + Intergenic
924871437 1:248050803-248050825 ATTTGGAATCAAGATGAGATTGG - Intronic
1066492457 10:35906835-35906857 AATGGGAAGCCATGTGAGGTGGG + Intergenic
1068628330 10:59273388-59273410 GTAGGGTTTCCAAATGAGGTTGG - Intronic
1068773656 10:60849317-60849339 AGTGTGAATCCAAAGGAGCTTGG + Intergenic
1068966396 10:62916155-62916177 ATTGGTAAAACAAAGGAGGTTGG + Intronic
1069384925 10:67875552-67875574 ATTGGGGCTCTAAATGAGGAAGG - Intergenic
1069714841 10:70514052-70514074 TGTGGGAATGCAAATCAGGTCGG - Intronic
1070055973 10:72934934-72934956 ACTGGGAATACCAATGGGGTAGG + Intergenic
1072000282 10:91188628-91188650 AATGAGAATCCAAATGAAGGCGG - Intronic
1076605606 10:131687318-131687340 ATTGGAAAACAAAATGAAGTAGG + Intergenic
1077128227 11:954246-954268 GGTGGGAATCCAAGTGAGGTGGG - Intronic
1080486497 11:32713389-32713411 ATTGGGATTCCTACTGAGATCGG - Intronic
1081608038 11:44539609-44539631 CTTAGGAATCCAGAGGAGGTGGG - Intergenic
1081752335 11:45520401-45520423 AACTGGCATCCAAATGAGGTTGG - Intergenic
1085386302 11:76160149-76160171 ATTTGGAGTGCAGATGAGGTGGG + Intergenic
1088229265 11:107657179-107657201 ATTGGGAATCAAGATGACATTGG + Intronic
1089905342 11:122032411-122032433 ATTCGAAACCCAAATGAGTTTGG - Intergenic
1090531460 11:127595210-127595232 ATTTGGATTCAAAATGAGCTTGG + Intergenic
1091021602 11:132104995-132105017 CATGGGAAGCCAAATGAGGAGGG + Intronic
1091999277 12:5019291-5019313 ACTGGGGATCCACATGAGGTGGG - Intergenic
1095918494 12:47504844-47504866 ATTGGAAATCCTAGCGAGGTTGG + Intergenic
1096018649 12:48303139-48303161 TTTGGGAATCCAAATAAAGAGGG + Intergenic
1099954673 12:89341991-89342013 ATTCTGATTCCTAATGAGGTTGG - Intergenic
1101368693 12:104102786-104102808 ATTGTAGATCCAAATGAGGTAGG + Intronic
1101757330 12:107631106-107631128 AATGGGGATCCAAAAGAGGTAGG - Intronic
1102687126 12:114734009-114734031 ACTGGGAATCCAGGTGAGGGAGG - Intergenic
1104240245 12:126981581-126981603 ATTGGAAATCCAAAAGAAGACGG - Intergenic
1105953880 13:25261059-25261081 TTTGGGAGGCCAACTGAGGTGGG + Intronic
1107754475 13:43604796-43604818 AAAGGGAATCCAAATTAGGGGGG + Intronic
1107914264 13:45133275-45133297 GTTGGGAGTCAAAGTGAGGTGGG + Intronic
1112385625 13:98937090-98937112 GTTGGGCATTCAAATGATGTTGG - Intronic
1113079802 13:106506788-106506810 GATGGGAATCCAGATGTGGTGGG - Intronic
1113393320 13:109918728-109918750 ATTGGGAATATTAATGTGGTCGG + Intergenic
1114271482 14:21102962-21102984 ACTGGGAATCCAAATGATTGAGG + Intronic
1116587609 14:46728529-46728551 ATTGGCATTTCAAATAAGGTTGG - Intergenic
1117604288 14:57410518-57410540 AATGTGAATCCAAATCAAGTGGG - Exonic
1119966848 14:78926081-78926103 ATTTGGAGTCAAAAAGAGGTAGG - Intronic
1121812645 14:96904949-96904971 AATAAGAATCCAAATGAGGTTGG + Intronic
1126858867 15:52864805-52864827 AATGGTATTCCAAATGTGGTAGG - Intergenic
1127034281 15:54897624-54897646 ATTGAGAATCCAGCTGAGTTTGG - Intergenic
1129627496 15:77217603-77217625 ATTAGGAAACCAAAAGAAGTCGG - Intronic
1130367223 15:83251666-83251688 AGTAGGACTGCAAATGAGGTTGG + Intergenic
1130751392 15:86716813-86716835 ATTGGGAATCCAAATGAGGTGGG + Intronic
1131289053 15:91089211-91089233 AGTGGGAATGGAAATGAGGAGGG + Intergenic
1133273518 16:4623397-4623419 CTTGGGAAGCCAAATGAGTACGG - Intronic
1134887018 16:17802489-17802511 TCTGGGAATCCAAATGTGGGAGG - Intergenic
1136123071 16:28153520-28153542 TTTGTGAATACAAATGAGTTGGG - Intronic
1139997763 16:70996658-70996680 TTTTGGAATTCAAATGAGGGAGG + Intronic
1141979974 16:87544136-87544158 CTTGGGAACGCAAATGAGGTTGG - Intergenic
1145047529 17:19629821-19629843 ATTGGGAATCCAAGAGTGCTTGG - Intergenic
1147893663 17:43735866-43735888 ATTGTATATCCATATGAGGTAGG - Intergenic
1148667154 17:49383311-49383333 CTTGGGAATCCAGATGGGTTGGG - Intronic
1148796256 17:50198373-50198395 AATGGGTATCCAGAGGAGGTGGG - Intronic
1151490325 17:74429157-74429179 AGTAGGAATCCAACTCAGGTGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153687621 18:7562326-7562348 AGTTGGAATTCAAATGAAGTTGG + Intergenic
1156358678 18:36364697-36364719 AATGGGAATCCAATTGTGTTTGG - Intronic
1156424035 18:36989225-36989247 TTTGAGAATAAAAATGAGGTTGG + Intronic
1157418527 18:47526184-47526206 AATGGGAATCAAATTGAGTTGGG - Intergenic
1158895902 18:61912571-61912593 ATTGAGAATCTACTTGAGGTAGG - Intergenic
1158980549 18:62756465-62756487 ATTGAGAATCCAGAAGTGGTTGG + Intronic
1163630014 19:18413535-18413557 CTGGGAAATCAAAATGAGGTTGG - Intergenic
1165466365 19:35977352-35977374 ATTGGGGAAGCATATGAGGTGGG - Intergenic
1165723245 19:38094491-38094513 TTTGGGAAGCCAAAGGAGGAGGG - Intronic
1166750753 19:45163043-45163065 AGTGGGTATCAAATTGAGGTGGG - Exonic
926834888 2:17007621-17007643 AGTGGGAAGCCAACAGAGGTTGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927613412 2:24565546-24565568 ATTGGGAATCCTAATGTCATGGG + Intronic
934930679 2:98420201-98420223 TTTGGGAATACAGATGAGGAAGG + Intergenic
936404459 2:112189764-112189786 ATTGGGAATCATCATGAGGTGGG - Intergenic
936933587 2:117815451-117815473 ACTGGGACTGCAAATGAGGTAGG - Intronic
941941306 2:171041407-171041429 GTGGGGAATCCAGATGTGGTGGG - Intronic
945896573 2:215489326-215489348 AGTGGGCATCCAAATGATGAGGG - Intergenic
946119578 2:217498086-217498108 AGTGGGATGCCAAATGAGGGTGG + Intronic
947245792 2:228046905-228046927 ATGTGGAATCATAATGAGGTTGG - Intronic
1170285674 20:14705667-14705689 ATTGGGAATAAAAATGTGTTGGG + Intronic
1171325211 20:24285109-24285131 CTTAGGAATCCAAATGAGGGAGG - Intergenic
1171424601 20:25041758-25041780 ACTGGGAATCCACATGAGATGGG + Intronic
1174645621 20:52082899-52082921 ATTGGGAATCCAAGTTTGCTGGG + Intronic
1175800608 20:61799233-61799255 ATTGGGAATTGCAAAGAGGTAGG + Intronic
1177650372 21:23952790-23952812 AATGGGAAACCAAATAATGTTGG - Intergenic
1179967255 21:44814674-44814696 TTCGGGAATCCAACTGAGGACGG + Intronic
1181910055 22:26231445-26231467 ATTGAGAATCAAGCTGAGGTAGG - Intronic
1184805157 22:46790381-46790403 ATTAAGAATACGAATGAGGTGGG - Intronic
949361352 3:3235462-3235484 AGTGGGATTCCAAATGAGGAGGG - Intergenic
949683678 3:6543906-6543928 ATTAAGAATACCAATGAGGTTGG - Intergenic
952164587 3:30733385-30733407 ATTGGGAACCCAGATTACGTGGG - Intronic
952173523 3:30835866-30835888 ATTGTGAATCCAAGTAAGGGAGG - Intronic
957657051 3:83093835-83093857 TTTGGGAGGCCAAATGGGGTGGG + Intergenic
960140216 3:114144427-114144449 ATTGGGCTTTCAAATGAAGTTGG + Intronic
962508860 3:136078021-136078043 TTTGGGAAGGCATATGAGGTGGG - Intronic
963296006 3:143547536-143547558 ATGGAGAGCCCAAATGAGGTGGG - Intronic
967303454 3:188038890-188038912 ATTGGGAATGCAAAGGAGTGAGG + Intergenic
969130745 4:4989574-4989596 CTTGTGAAGCCAAAAGAGGTGGG + Intergenic
970056790 4:11983028-11983050 ATTGGGGATTCAAATGGGGTTGG - Intergenic
970253296 4:14139964-14139986 ATTGGGAAAGTAAATGAGGCAGG + Intergenic
970322015 4:14884274-14884296 ATTTAGAATCCAAAAGAGCTAGG + Intergenic
975766333 4:77671894-77671916 ATGGGGAATTCAAAGGAAGTGGG - Intergenic
977272987 4:94940998-94941020 ATTGGGAATTTCAATGAGGAAGG + Intronic
980397156 4:132228357-132228379 AGTGGGAAGCCAAGTCAGGTTGG + Intergenic
992506558 5:77392802-77392824 AGTGGGATTCCAAATGAGGGAGG + Intronic
993868534 5:93222923-93222945 ATTTTGCATCCAAATGAGTTTGG - Intergenic
994020745 5:95022625-95022647 AATGGGAATCTAAATAAAGTTGG + Intronic
1004032930 6:11889348-11889370 TTTGGGAATAGAAATGAGCTTGG - Intergenic
1008893064 6:56518840-56518862 TCTGGAAATCCAGATGAGGTGGG + Intronic
1009413008 6:63388116-63388138 ATTGGGAGGCCAAAGCAGGTAGG - Intergenic
1010132059 6:72505827-72505849 ATTTAAAAACCAAATGAGGTAGG - Intergenic
1011175070 6:84551222-84551244 ATTGGGTATCCAAGTCAGGGGGG - Intergenic
1011582205 6:88881537-88881559 ATTTGGAATAAAAATGAAGTTGG - Intronic
1013875935 6:114828411-114828433 ATTGGGAATGCAAAGAAGGTGGG - Intergenic
1015628134 6:135203177-135203199 ATTTGAAATTTAAATGAGGTTGG - Intronic
1018359921 6:163056946-163056968 AGTGGGATTCCTAATGAGGGAGG + Intronic
1021061451 7:16117718-16117740 GGTGGGAATGCAGATGAGGTTGG - Intronic
1021795093 7:24246536-24246558 AGTGGAAATCCAAATGAAGTGGG - Intergenic
1023085418 7:36565781-36565803 ATTGGGAAGCCGAAGCAGGTAGG - Intronic
1024241386 7:47439090-47439112 ATTAGGAAGACAAATTAGGTGGG - Intronic
1025935312 7:66031214-66031236 CTTGGGATCCCAACTGAGGTAGG - Intergenic
1027581775 7:80005673-80005695 GTTGGACATCCAAATGAGGATGG + Intergenic
1027971578 7:85089636-85089658 TTTGGGATTACAAGTGAGGTGGG + Intronic
1032896824 7:136260822-136260844 AATGGGAATACAATTGATGTAGG + Intergenic
1033469459 7:141631852-141631874 ATGAGAAATCCAAATGAGGCCGG - Intronic
1033951372 7:146788582-146788604 TTTGGGAATATAAATGTGGTGGG - Intronic
1036275099 8:7343848-7343870 ATTGTTAAACCAAATGAGCTTGG - Intergenic
1036346257 8:7966500-7966522 ATTGTCAAACCAAATGAGCTTGG + Intergenic
1036841578 8:12127258-12127280 ATTGTTAAACCAAATGAGCTTGG + Intergenic
1036863389 8:12373505-12373527 ATTGTCAAACCAAATGAGCTTGG + Intergenic
1040905167 8:52461579-52461601 ATTTGGGATCCAAATGAACTAGG + Intergenic
1043448069 8:80338987-80339009 ATTGAGTATCCAGGTGAGGTAGG - Intergenic
1045457438 8:102395127-102395149 ATTGTGAATGAAAAGGAGGTAGG - Intronic
1049908675 9:244326-244348 ATTGGAAATGGAAATGAAGTTGG - Intronic
1052870073 9:33496706-33496728 CTTGGGAACCTAAATGAGTTAGG - Intergenic
1053215124 9:36264516-36264538 AGTGGGGATCGAAATAAGGTTGG - Intronic
1056027757 9:82517139-82517161 ATTGGAAATAAAACTGAGGTAGG + Intergenic
1056292337 9:85156532-85156554 CTTAGGAATCCAAGTGAGGAAGG - Intergenic
1056305191 9:85283468-85283490 ATTCTGAAGCCAAATGAGGGCGG + Intergenic
1058230877 9:102422767-102422789 ATTAAGAATTCAAATGATGTTGG + Intergenic
1058794503 9:108484685-108484707 AATGGGAAGCCAGGTGAGGTTGG - Intergenic
1060311366 9:122465511-122465533 ATTGAGGATCCAAATTAGTTTGG - Intergenic
1188736558 X:33724749-33724771 GTTAGGAATCTAAATCAGGTGGG - Intergenic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1189980113 X:46501500-46501522 ATTAGGTATCAAAATGAAGTGGG + Intronic
1193022477 X:76805104-76805126 ACTAGGAATCCAAATGTGATAGG - Intergenic
1194934914 X:99937295-99937317 ATAGGGTATGCAAATAAGGTGGG + Intergenic
1196835559 X:119810767-119810789 ATTAGGAAACCAAAAGAAGTTGG - Intergenic
1200017826 X:153179674-153179696 AATGGGAATGCGAATGGGGTGGG - Intronic