ID: 1130751433

View in Genome Browser
Species Human (GRCh38)
Location 15:86717207-86717229
Sequence GAGAACAAGGAGAAGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1194
Summary {0: 1, 1: 0, 2: 5, 3: 94, 4: 1094}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130751433 Original CRISPR GAGAACAAGGAGAAGGAGTG GGG Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900724418 1:4206267-4206289 GAGAACATGGACATAGAGTGTGG - Intergenic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901240408 1:7689760-7689782 GAGAGCATGCAGAAGGAGTCAGG - Intronic
901724297 1:11228631-11228653 GAGGAGAAAGAGAAGGATTGGGG + Intronic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
901751693 1:11413915-11413937 GAGAAGGGGGAGAAGGAGGGAGG - Intergenic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902337234 1:15760607-15760629 GGGAACAAGGAGTAGGAAGGAGG + Intronic
902717894 1:18285134-18285156 GAAAACAAAGAGAAGGAGGTTGG + Intronic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
904120797 1:28196492-28196514 GGGAACAACCAGCAGGAGTGGGG + Intergenic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904336751 1:29802789-29802811 GAGGAAGTGGAGAAGGAGTGGGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904715254 1:32463176-32463198 GAGGACGAGGAGGAGGAGAGAGG - Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
906066510 1:42984849-42984871 GGGAAGAAGGAGGAGGAGCGGGG + Intergenic
906180847 1:43817597-43817619 GAGAAGGAGGAGAAGGAGAAGGG - Intronic
906199085 1:43947670-43947692 GAGAACGTGGAGAAGGTATGAGG + Exonic
906274832 1:44507877-44507899 GAGAAAAAGAAGGGGGAGTGTGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906503238 1:46357643-46357665 GAGGACACTGAGAAGGAGTAAGG + Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906708071 1:47909495-47909517 GAGAAGGAGGAGAAGGAGAAGGG + Intronic
907715394 1:56921761-56921783 GAAAACCAGGAGATAGAGTGTGG + Intergenic
907990516 1:59578139-59578161 GAAGACAAGGAAAAGGTGTGTGG + Intronic
908166177 1:61461627-61461649 GAGAACAGGGAGACAGTGTGTGG + Intronic
908251271 1:62267871-62267893 GGTAACAATGAGAAGGACTGGGG + Intronic
908767744 1:67569690-67569712 AAAAAAAAGGAGAGGGAGTGGGG + Intergenic
908911028 1:69072345-69072367 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910571025 1:88703063-88703085 GAGAAAAGGGACAAGGAGTGCGG - Intronic
910619453 1:89236585-89236607 GAGAACAAGAAAAAGCAGGGTGG - Intergenic
911242680 1:95483023-95483045 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911637357 1:100249778-100249800 GAGAACCTGGAGCAGGAATGCGG - Exonic
912393728 1:109323198-109323220 AAGAACAAGGAGAGGGAAAGTGG + Intronic
912423797 1:109567941-109567963 GAGAAAAAAGAGAAGGACTCAGG + Intronic
914204782 1:145517552-145517574 AAGAAGAAGAGGAAGGAGTGTGG + Intergenic
914285807 1:146226349-146226371 GAAAACAAGGAGCAAGAGTATGG + Intronic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
914370780 1:147022675-147022697 AAGAAGAAGAGGAAGGAGTGTGG - Intergenic
914546839 1:148677102-148677124 GAAAACAAGGAGCAAGAGTATGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916495628 1:165344369-165344391 GAGCAAGAGGAGAAAGAGTGAGG + Intronic
916675829 1:167063750-167063772 GAGACCAAAGAGAAGGCATGAGG + Intronic
916976034 1:170079703-170079725 GAGAAAAAGAAGAAAGATTGAGG - Intronic
916986099 1:170192413-170192435 GAGAACAAAGAAAAGCAGGGTGG - Intergenic
917424841 1:174902788-174902810 GAGAACAAAGAAAAGTAGTGTGG - Intronic
917455775 1:175184387-175184409 GAGAAGAAGGGTAGGGAGTGGGG - Intronic
917682838 1:177385094-177385116 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
917930499 1:179819283-179819305 GAGAAAACTGAGAAGGAGAGAGG - Intergenic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918315892 1:183322509-183322531 GAGGAGCAGGAGTAGGAGTGGGG - Intronic
918993221 1:191725600-191725622 GAGAAAAAAGAGAAAGAGAGAGG + Intergenic
919530847 1:198717801-198717823 GAGAAAAAGGGAAGGGAGTGGGG - Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920071151 1:203304321-203304343 GAGAAAAGGGAGGAGGACTGAGG + Intergenic
920254818 1:204647516-204647538 GACAACAAGGAAAGGGAGAGAGG + Intronic
920764212 1:208816131-208816153 GAGGAAAAGGAGAAGCAGGGAGG - Intergenic
920776563 1:208943786-208943808 GAGAAAGAGGAGAAAGAGGGTGG + Intergenic
920928201 1:210362693-210362715 GAAAGCAAGGTCAAGGAGTGTGG + Intronic
921034219 1:211360974-211360996 AAGGACCAGGAGAAGGAGAGAGG - Intronic
921070784 1:211655989-211656011 GGGAAAGAGGAGCAGGAGTGGGG - Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921163224 1:212487511-212487533 GGGAGCAAGGAGGAGGAGAGAGG - Intergenic
921508099 1:215998836-215998858 GAGAAGAAGTGGAAGGAATGGGG + Intronic
921640296 1:217544994-217545016 GAGAAAAACAAGAAGGAGAGGGG - Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
922390804 1:225138799-225138821 GAGAGTGAGGAGAAGCAGTGGGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922936293 1:229425710-229425732 GAGAAGAAAGAGGAGGAGGGGGG + Intergenic
923059623 1:230458902-230458924 GAGAAGGAGAAAAAGGAGTGAGG - Intergenic
923145941 1:231197871-231197893 GAGAAGAAGGAGAAGAAGAAAGG + Intronic
923532405 1:234821889-234821911 GAGAGCAAGGAGAATGTGAGTGG - Intergenic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
924063533 1:240200791-240200813 GAGAACATGGAAAAAGAGTTGGG - Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063419838 10:5903153-5903175 GAGAACAAAAAGAGGGAGTAGGG + Exonic
1063729639 10:8681617-8681639 GAGAAGGAGGAGAAGGAGAAGGG - Intergenic
1063938983 10:11107937-11107959 GAGAGCAAGGAGACGGGATGGGG - Intronic
1064142355 10:12801111-12801133 GAGAAGGAGGAGATGGAGTTGGG + Intronic
1064409959 10:15096763-15096785 GATAAAAGGGAGAAGGAGTATGG - Exonic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1065101087 10:22334340-22334362 GAAAATAAGGAAAAGGAGAGAGG - Intergenic
1065521750 10:26580081-26580103 GCGAACTAGGAGCAGGAGGGAGG - Intergenic
1065768442 10:29053912-29053934 GAGAACAAGAAGCAGGTGAGAGG + Intergenic
1065913413 10:30330619-30330641 GTGAACCATGAGCAGGAGTGTGG + Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066058096 10:31699858-31699880 GGGAACCTGGGGAAGGAGTGGGG + Intergenic
1066160854 10:32725990-32726012 GAATACAAAGAGAAGGAATGTGG - Intronic
1066459866 10:35603683-35603705 GAGAAAAAAGACAAGGAATGGGG + Intergenic
1066478699 10:35773816-35773838 TGGAACACGGAGAAGGAGGGGGG + Intergenic
1067166507 10:43869881-43869903 GAGGAGGAGGTGAAGGAGTGGGG + Intergenic
1067365081 10:45619524-45619546 AAGAACAAGTGGAAGGAGTGAGG + Intronic
1067558167 10:47286648-47286670 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1068231906 10:54178612-54178634 AAGAACAATGAAAAGAAGTGGGG + Intronic
1068512695 10:57986110-57986132 GAGAACCAGCAGAACCAGTGGGG - Intergenic
1069677586 10:70259701-70259723 GAGAACAAGGAGGAGGGGATGGG + Intronic
1069859664 10:71462428-71462450 GAGGAGAAGGAGGAAGAGTGGGG + Intronic
1070327455 10:75397743-75397765 GGGAAGAAGGAGTAGCAGTGAGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070670338 10:78373210-78373232 GAGAAAATGGAGAGGGGGTGAGG - Intergenic
1070680551 10:78446080-78446102 GAGAAGGAGGAGAAGGAGAAGGG + Intergenic
1070800208 10:79240769-79240791 GAGAACAGGGAGATGGGGTAGGG + Intronic
1070810945 10:79297910-79297932 GAAAACAAGGAGAGGGAGAGGGG + Intronic
1071497564 10:86179316-86179338 GAGAGCAAGGAGAAAGATGGAGG - Intronic
1071523997 10:86347623-86347645 GAGAGCAGGGACAAGGGGTGTGG + Intronic
1071631527 10:87222686-87222708 GTGAGCAAGGGAAAGGAGTGCGG + Intergenic
1072431396 10:95374706-95374728 GAGAGAAAGGAGAAGAAATGAGG + Intronic
1072464602 10:95651627-95651649 GGGAACAAGAAGAGAGAGTGAGG + Intronic
1072822953 10:98576525-98576547 GAGGACAAGGAGAAGCAGAGAGG + Intronic
1072872215 10:99132588-99132610 GAGAGCAAGACGAAGGAGGGTGG + Intronic
1073249851 10:102114746-102114768 GAGAAGGAGGAGGAGGAGAGAGG - Intronic
1073308478 10:102522427-102522449 GAGAGAAAGGAGGAGGCGTGTGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073757032 10:106591861-106591883 GAGAAATAGGTGAAGAAGTGGGG + Intronic
1074538108 10:114343470-114343492 GAGACAAAGGAGCAGGGGTGAGG - Intronic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1075453325 10:122568505-122568527 GAGAGGAAGAAGGAGGAGTGAGG + Intronic
1076122712 10:127949070-127949092 GAGAACCAGGGGATGGATTGAGG - Intronic
1076260040 10:129058111-129058133 GAGATCAAGCAGCAGGGGTGCGG - Intergenic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076989817 11:267234-267256 AGGAGCAAGGAGGAGGAGTGAGG + Intergenic
1077198510 11:1293466-1293488 GACAACAAGGGGAAGCAGCGAGG + Intronic
1077323949 11:1955496-1955518 GAGAAGAGGGAGGAGGAGTGAGG - Intronic
1077724693 11:4662274-4662296 GAGAGGAAGGAGAGGGAGGGAGG - Intergenic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077923238 11:6656318-6656340 GAGATCAAGCAGAAGGGGTAAGG - Intergenic
1077923274 11:6656486-6656508 GGGAATGAGGAGAAGGCGTGAGG - Intergenic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078245262 11:9568412-9568434 GAGAACAAGCATAAGGAGAAAGG + Intergenic
1078366401 11:10710179-10710201 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1078496128 11:11818909-11818931 GAGAGGAAGGAGAAAGACTGTGG - Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078659664 11:13277272-13277294 AAGAAGAAGGAGGAGGGGTGAGG + Intronic
1078691139 11:13582125-13582147 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1078948493 11:16099994-16100016 GAGAACAAGGACAAGGCAGGAGG + Intronic
1079155136 11:17939195-17939217 CAGAACAAGGAGAACAAGAGGGG + Intronic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079588134 11:22150493-22150515 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1079703937 11:23589050-23589072 GAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080573398 11:33577253-33577275 GAGAAGAAGAACAAGGTGTGGGG + Intronic
1080825205 11:35842538-35842560 GAGATAAATGAGAAGGAGAGAGG + Intergenic
1080857404 11:36124203-36124225 GACAAAAAGGAGAAGGAATGAGG - Intronic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1082180151 11:49107048-49107070 GAGGAAAAAGAGAAAGAGTGGGG + Intergenic
1082993842 11:59233398-59233420 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1083334215 11:61913408-61913430 GAGACCATGGAGGAGGAGTGGGG + Intronic
1083367204 11:62148540-62148562 GAGAAGAAGAAGAAGGTGAGGGG + Exonic
1083571446 11:63764037-63764059 GAGGAGGAGGAGGAGGAGTGGGG - Exonic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083822679 11:65181860-65181882 GAGGAGGAGGAGAAGGAGAGAGG + Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085020229 11:73202079-73202101 GAGAGCCAGGGGAAGGGGTGGGG - Intergenic
1085040529 11:73323952-73323974 GAGAACAGGGAGAAGGACAGAGG - Intronic
1085127046 11:74008918-74008940 GAGAACAAGGAGAAGGGAGAGGG + Intronic
1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG + Intergenic
1085477819 11:76798931-76798953 GAGAACAAACAGGAGGACTGTGG - Intergenic
1085931520 11:81089061-81089083 GAGAAAATGAAGATGGAGTGAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086410633 11:86540984-86541006 GAGAGCAAGGTGAAGCAGGGTGG + Intronic
1086426472 11:86688723-86688745 GTGAACAAGGAGAGGGAGAGAGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1087062422 11:93993252-93993274 GCGAACAGGGAAAAGGAGGGAGG - Intergenic
1087065142 11:94021025-94021047 GAAAAGAAGAAGAAGGGGTGGGG + Intergenic
1087354307 11:97074528-97074550 GAGAACAAAGAAAAGCAGTGTGG - Intergenic
1087443928 11:98222005-98222027 AAGAACAAGGAGGTGGGGTGCGG - Intergenic
1087652933 11:100889397-100889419 GAGGACACAGAGGAGGAGTGAGG + Intronic
1087881211 11:103418682-103418704 GAGAACAAAGAAAAGCAGTGTGG + Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088017730 11:105081282-105081304 GAAAGCAAGGAGAAGCAGTGTGG + Intronic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1089589224 11:119529902-119529924 GGGAACCAGGACAAGGTGTGGGG - Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089607805 11:119651751-119651773 TAGATCATGGAGATGGAGTGGGG + Intronic
1090231023 11:125103748-125103770 GAAAACCAGGAGAGGTAGTGTGG - Intronic
1090285260 11:125494901-125494923 GGGAAGAAGGAGATGGAATGGGG - Intronic
1090451753 11:126812298-126812320 GATAATAATGAGAAGGACTGGGG + Intronic
1091025170 11:132135485-132135507 GAGAACAGGCAGAAGGTGTAAGG + Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1202806935 11_KI270721v1_random:10691-10713 GAGAAGAGGGAGGAGGAGTGAGG - Intergenic
1091446704 12:547910-547932 AAGAGCAAGGAGAAGGGATGAGG + Intronic
1091528455 12:1330419-1330441 AAAAACTGGGAGAAGGAGTGAGG - Intronic
1091602692 12:1927695-1927717 GAGGACAAGGGGAAGCAGAGGGG + Intergenic
1091694920 12:2622042-2622064 GAGAGGAAGGAGAAGGAAAGGGG + Intronic
1091780694 12:3212951-3212973 GTGGACAAGCAGAGGGAGTGGGG + Intronic
1092089439 12:5792310-5792332 AACAAAATGGAGAAGGAGTGAGG - Intronic
1092155733 12:6280495-6280517 GAGAAGGAAGTGAAGGAGTGGGG + Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092343333 12:7694809-7694831 GAGAACTAGGGGCAGGAATGGGG + Intronic
1092801877 12:12176576-12176598 GAAACCAGGGAGAAGGAATGGGG - Intronic
1092943956 12:13436055-13436077 GAGATGGAGGAGAAGAAGTGAGG - Intergenic
1093705080 12:22266129-22266151 GAAAGTAAGGAGAAGGGGTGAGG - Intronic
1094083775 12:26566220-26566242 GAGAAGAAGGAGGAGGAAAGAGG + Intronic
1094085555 12:26587585-26587607 GAGGACAAGGGGAAGAAGGGTGG + Intronic
1094229435 12:28085884-28085906 GGTAACCAGGACAAGGAGTGTGG + Intergenic
1094366310 12:29686418-29686440 GATAACATGAAGAGGGAGTGAGG + Intronic
1094693421 12:32792753-32792775 GAGATCAGGGAGAATGAGTGAGG + Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095659089 12:44708067-44708089 GAGAAGAACCAGAAGGACTGTGG + Intronic
1095679662 12:44959169-44959191 TACAACAAGGTGAATGAGTGAGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096261748 12:50097051-50097073 GAGACCCAGAGGAAGGAGTGAGG + Intronic
1096553746 12:52390774-52390796 GGGAACAAGGAGGAGCTGTGTGG + Intergenic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1096797848 12:54089794-54089816 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1097424308 12:59423461-59423483 GAGAACAGTGAGAAGGATTTTGG - Intergenic
1097498356 12:60372840-60372862 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1097744445 12:63285755-63285777 GAGAACAAGGTGGAGGTGAGTGG - Intergenic
1097894438 12:64810253-64810275 GAAAACATGGAGAAGGAGAATGG - Intronic
1098201908 12:68064678-68064700 GAGAGCAAGGAAAAGTAGGGTGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098231478 12:68375810-68375832 GAGAAAAAGATGAAGGAGTATGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098758957 12:74399709-74399731 GAACACAAGGAGGAAGAGTGAGG - Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099621504 12:85007518-85007540 GAGGAGAGAGAGAAGGAGTGGGG + Intergenic
1100153427 12:91769459-91769481 GAGAACAAAGAAAAGAAGAGAGG + Intergenic
1100353230 12:93804520-93804542 GAGAACAATGAAATGTAGTGCGG + Intronic
1100535307 12:95503396-95503418 GAGAACAAGAAAAATGAGTATGG + Intronic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101202446 12:102451008-102451030 GATAACAAGGAGAAAGATTTTGG + Intronic
1101484080 12:105133399-105133421 GGGAAAAAGGATAAGGACTGGGG - Intronic
1101580504 12:106037764-106037786 GAGAAGGAAGAGAAGGAGAGGGG - Intergenic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102202562 12:111067767-111067789 GAGAACAAGGGGACAGAGGGAGG + Intronic
1102407156 12:112683510-112683532 GATTCCAAGGAGGAGGAGTGAGG + Intronic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103344782 12:120241964-120241986 GTGGATATGGAGAAGGAGTGAGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1104085139 12:125467372-125467394 GAGAAAGAGGAGGAGGAGAGGGG - Intronic
1104301430 12:127568575-127568597 GAGAGAGAGGAGAAGGAGAGAGG + Intergenic
1104373244 12:128242913-128242935 GAGAAAAAGGAGGCAGAGTGAGG + Intergenic
1104402421 12:128487240-128487262 TAGAACAAGGAGGATGGGTGAGG - Intronic
1104683855 12:130771571-130771593 GTGAAGAAGGTGGAGGAGTGGGG - Intergenic
1104707889 12:130961433-130961455 GAGAAAATGGAGGAGGGGTGGGG - Intronic
1104738594 12:131155458-131155480 GAGAACAAGTGGAAGGTCTGAGG - Intergenic
1104782783 12:131432554-131432576 GAGAATGAGGAGGAGGAGTTGGG + Intergenic
1106389963 13:29325507-29325529 GAGAAGGAGGAGGAGGAGGGAGG + Intronic
1106454651 13:29916526-29916548 GGGAACAGGGCCAAGGAGTGGGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107143712 13:37034072-37034094 GAGAAGAAGGAGAAAGATAGGGG - Intronic
1107192297 13:37604122-37604144 GAGAACAAGAAGAAGAAATATGG - Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107336321 13:39359622-39359644 GAATACAAGGAGAAGGAGGTAGG + Intronic
1107976438 13:45693071-45693093 GAGAAAAAGGCAAAGGACTGTGG + Intergenic
1108105885 13:47008616-47008638 AAGACCAATGAGAAAGAGTGGGG - Intergenic
1108269860 13:48748953-48748975 CAGAACAAGCAGCAGGTGTGAGG - Intergenic
1108345257 13:49539544-49539566 GTTAACAAGGAGGAGGAGCGTGG + Intronic
1108479658 13:50856009-50856031 GAGAACAAAGAAAAGCAGGGTGG + Intergenic
1108605468 13:52033500-52033522 GAGAACAAGGAGACTATGTGAGG - Exonic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1109049322 13:57458276-57458298 AAGAGCAAGGAGAAGGGATGAGG + Intergenic
1109789638 13:67230304-67230326 GAGGAGAGGGAGAAGGAGAGAGG - Intronic
1109989842 13:70040303-70040325 GAGAAAGAAGAGAGGGAGTGGGG + Intronic
1110193232 13:72755951-72755973 GAGAACCAAGAGAAAAAGTGGGG + Exonic
1110408859 13:75182416-75182438 GACAGACAGGAGAAGGAGTGGGG - Intergenic
1110567249 13:76968566-76968588 GAGAGCAAGGAAGAGCAGTGTGG - Intergenic
1111181012 13:84665106-84665128 GATAACAAGGAGAAGAAGACAGG + Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1112100258 13:96180873-96180895 GAAAAAAAGGAGAAGGAAAGAGG - Intronic
1112182727 13:97100909-97100931 GAGAAAAAGGAGGGGGATTGGGG - Intergenic
1112422517 13:99265581-99265603 GAGAACAAGAAGAAGAAAAGGGG - Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112827506 13:103408609-103408631 GGGAACATGGAGCAGGAGTTGGG - Intergenic
1113159616 13:107365024-107365046 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
1113341957 13:109434354-109434376 GAGAACAGGGAGACAGAGAGAGG + Intergenic
1113372118 13:109733675-109733697 GAGCACGTGGAGAGGGAGTGGGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113741328 13:112714211-112714233 GAAAACAAGGGGAAAGAGAGCGG - Intronic
1114195019 14:20469519-20469541 GAGACCATGGAGAACGGGTGAGG + Exonic
1114258166 14:21019751-21019773 GAGAACAAGGAGAAAAATTAGGG + Intronic
1114355426 14:21902983-21903005 GAGACCAAGAACAAGAAGTGTGG - Intergenic
1114655639 14:24314029-24314051 GAGCATGAGGAGCAGGAGTGAGG - Exonic
1114862259 14:26538681-26538703 ATGAACAAGGGAAAGGAGTGGGG - Intronic
1114958116 14:27848940-27848962 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1115058243 14:29157098-29157120 GAGAACAAGAAGAAGGACTGTGG + Intergenic
1115415411 14:33126678-33126700 GAGAACAAGTGGAAAGACTGTGG + Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115877410 14:37876145-37876167 GAGCACCAGAAAAAGGAGTGTGG + Intronic
1116037538 14:39645508-39645530 AAGGATAAGGAGGAGGAGTGGGG + Intergenic
1116185404 14:41594141-41594163 GAGAGCTAAGAGAAGGAGTCAGG + Intergenic
1116394425 14:44430575-44430597 GTGGAGAAGGAGGAGGAGTGGGG - Intergenic
1116833501 14:49746108-49746130 GATGCCAAGGAAAAGGAGTGGGG + Intronic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117649066 14:57883033-57883055 GAGAAGGAGGAGAAGGGGAGGGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1118072565 14:62261934-62261956 GAGAAAAAGGAGGAGGAAAGTGG - Intergenic
1118136087 14:63029655-63029677 GAGAAAAATGAGAAGAAGAGAGG + Intronic
1118171699 14:63395446-63395468 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1118190397 14:63574893-63574915 GAGAAGGGAGAGAAGGAGTGGGG - Intergenic
1118459544 14:65976007-65976029 GGGAAGCAGGAGAAGGAGGGAGG + Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119110901 14:71972849-71972871 GAGAATAATGAGGAGGAATGAGG + Intronic
1119335523 14:73830391-73830413 AAGAAGAAGGAGAAGAAATGAGG - Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119843530 14:77811085-77811107 GAGAGCAAGGAGAAAGGGTAGGG + Intronic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120717496 14:87855401-87855423 GAGAACAAGTATAAGGAAGGGGG + Intronic
1121050557 14:90816616-90816638 GAGGACAGGGAGAGGGACTGGGG + Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121369567 14:93344808-93344830 GAGAACAAGGAGATGAGGTTAGG + Intronic
1121557361 14:94848539-94848561 GAGAAAATGGAGCAGGAGAGTGG + Intergenic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1121821495 14:96971763-96971785 GAGAAGGAGGAGAAGAAGGGAGG + Intergenic
1121905790 14:97741542-97741564 GAGAGGAAGGAGAAGCAGTGTGG - Intergenic
1122415209 14:101546259-101546281 GGGAACAGGGAGAAGAAGCGGGG + Intergenic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122930166 14:104929495-104929517 CAGGACAAGGAAAAGAAGTGAGG + Intronic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1123915675 15:25023639-25023661 GAGAGCAAGAAGAGGAAGTGGGG - Intergenic
1124203043 15:27694763-27694785 GAGAAAAAGGAAAAGGGGCGGGG - Intergenic
1124904702 15:33857683-33857705 GAAAACGAGGAGGAAGAGTGAGG - Intronic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125283256 15:38066092-38066114 GAGAAAAAGGGGAAGGAGAGAGG + Intergenic
1125596584 15:40891146-40891168 GAGGCAAAGGAGAAGCAGTGAGG - Intergenic
1125707285 15:41750076-41750098 GAGGCCAAAGAGAAGGAATGTGG + Exonic
1126367603 15:47912072-47912094 GAGAAATAAGAGAAGCAGTGAGG + Intergenic
1126858812 15:52864377-52864399 GAAAGCTAGGTGAAGGAGTGAGG - Intergenic
1127218911 15:56856377-56856399 GAGAATATTCAGAAGGAGTGAGG - Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1127365342 15:58284283-58284305 GGGCACAGGGAGAAGGAGGGAGG + Intronic
1127691055 15:61398366-61398388 AAAAACAAGGAGAAGGAAAGTGG + Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1127992682 15:64132484-64132506 GATCACCAGGAGAAAGAGTGAGG - Intronic
1128293068 15:66493965-66493987 GATGACAAGGGGAAGGACTGAGG - Exonic
1128304121 15:66586951-66586973 GAGGAGAAGGAGGAAGAGTGGGG - Intronic
1128364254 15:66986125-66986147 AACCAGAAGGAGAAGGAGTGTGG - Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129429815 15:75491429-75491451 AAAAACAGAGAGAAGGAGTGGGG + Intronic
1129960180 15:79677137-79677159 GAGAACAATGAGAAAGATAGAGG + Intergenic
1130090350 15:80815608-80815630 GAAACAAAGGAGAAGGAATGAGG - Intronic
1130127427 15:81105409-81105431 AAGAAAGAAGAGAAGGAGTGAGG - Intronic
1130214005 15:81951611-81951633 GAGAACTAGGCTAAGGAGTCTGG - Intergenic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130857365 15:87852640-87852662 GAGAGCAAGGATAAAGAGTCTGG - Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131224413 15:90612022-90612044 GAGGAGGAGGAGGAGGAGTGGGG - Intronic
1133292099 16:4729041-4729063 GAGAACCAGGAGACAGAGTTAGG + Intronic
1133326527 16:4945396-4945418 GAGAAGAAGAAAAAGGAATGTGG - Intronic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133760815 16:8797165-8797187 GCGGAGAAGGAGAAGGAGCGAGG + Intronic
1135174297 16:20214567-20214589 GAGAAGAAGAGGAAGGGGTGGGG + Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1136186354 16:28591009-28591031 GAGGACAAAGGGAAGGAGTGGGG - Intronic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1136499742 16:30664411-30664433 GAGAACAAGGAGGGGTGGTGGGG - Exonic
1137031173 16:35526167-35526189 GAGAACAAGGAGACGAACTGTGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137800999 16:51262087-51262109 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1138118528 16:54379593-54379615 GGGGACAAGGAGAAGGAATGAGG + Intergenic
1138270286 16:55691168-55691190 GAGAGCAAGAAGAGGGAGGGAGG + Intronic
1138552891 16:57756997-57757019 GTGCACAAGGAACAGGAGTGGGG - Exonic
1138670689 16:58611900-58611922 GAGAAAAAGAAGTAGGTGTGAGG - Intronic
1139637361 16:68265804-68265826 GAGGACAAGGAGAGGAAGAGAGG - Intronic
1139762925 16:69201985-69202007 GTAAACAAGGAGAATGAGTCAGG - Intronic
1139925380 16:70483048-70483070 GAGAAGAGAGGGAAGGAGTGGGG - Intronic
1139954241 16:70685766-70685788 GAGACGGCGGAGAAGGAGTGCGG - Exonic
1140357602 16:74319581-74319603 GAGAAGAAGGAGAAGAAAGGAGG - Intergenic
1140963234 16:79937821-79937843 GAGGAGGAGGAGAAGGAGAGGGG - Intergenic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141320638 16:83005334-83005356 ATGAACAGGGAGAAAGAGTGAGG - Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141637123 16:85320104-85320126 GGCAACAAGGAGAAGCAGTCGGG + Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1142885047 17:2907301-2907323 GAGAAGAAGGGGAAGGGATGCGG + Intronic
1142928323 17:3260302-3260324 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143828196 17:9630038-9630060 GAGAAAAAGGGGAGGCAGTGAGG - Intronic
1144235668 17:13258079-13258101 GGGAAGAAGGAGAAGGAGAAGGG - Intergenic
1144354245 17:14428889-14428911 GAAAACAAGAAGAGGAAGTGAGG - Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144599095 17:16597555-16597577 GAGGACTTGGAGAGGGAGTGAGG + Intergenic
1144637238 17:16918103-16918125 GGGAACAAGGAGCAGGATTGGGG + Intergenic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145320792 17:21766096-21766118 GAGAACGTGGAGAAGCAGAGAGG + Intergenic
1145988908 17:29066296-29066318 GGGAGCAAGGAGTAGGGGTGGGG + Intergenic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1146679953 17:34799916-34799938 GAGAACAAGCAGGAGGAAGGGGG - Intergenic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1147421842 17:40325843-40325865 GAGAACAGAGAGAATGAATGAGG + Intronic
1148068139 17:44888679-44888701 GAGAAAAAAGAGAAGCAGTAAGG + Intronic
1148080393 17:44964792-44964814 GAAAACCAGGAGAAATAGTGGGG - Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148676559 17:49448892-49448914 GAGAGAAGGGAGAAGGGGTGAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149059299 17:52403545-52403567 GTGAACAAGGAGAAAGTGTGGGG + Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150432260 17:65127764-65127786 GAGTGCAAGGAGGAGGAGAGGGG + Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150557178 17:66264834-66264856 GAGAAGAATGAGAATGAGTGGGG - Intergenic
1150964176 17:69948489-69948511 GAGGAGAAGGAGGAGGAGAGGGG + Intergenic
1151316074 17:73323488-73323510 AGGAACAAGGGGAAGGAGCGTGG + Intergenic
1151568909 17:74916303-74916325 GAGAACAGGGAGAAGAGCTGTGG + Exonic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1153682644 18:7515051-7515073 GAAAAAAAGGAAAAGGGGTGGGG - Intergenic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1154031389 18:10756798-10756820 GAGAATGAGGAGGAGGAATGGGG + Intronic
1155066207 18:22271210-22271232 GAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155632684 18:27912558-27912580 TAGAAAAAGGAGAATGAATGAGG - Intergenic
1155878656 18:31117464-31117486 GAGAACAAAGAGAGGAAGGGAGG - Intergenic
1155890062 18:31256654-31256676 GAGAAGAAAGAGAAGAAGTAGGG + Intergenic
1156661235 18:39349097-39349119 GAGAACCAGATCAAGGAGTGGGG + Intergenic
1157357522 18:46949215-46949237 GAGAAGGAGGAGAAGTAGTTAGG - Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157505750 18:48225266-48225288 GAGAAAAGGGAGAGGGAGAGGGG + Intronic
1157894004 18:51447179-51447201 GAGCAAAAGGAGAAGGAAAGAGG + Intergenic
1158073950 18:53506868-53506890 AAAAAAAAGGAGGAGGAGTGTGG + Intronic
1158286980 18:55894505-55894527 GAGAAGAAATAGACGGAGTGAGG - Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158855719 18:61541921-61541943 GAGAACAGAGAGCAGGAGAGCGG + Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159050479 18:63416900-63416922 GATAGCAAAGAGAAGGAATGAGG - Intronic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1159868868 18:73738022-73738044 GAGAGCAAGCAGCAGGACTGGGG - Intergenic
1160111355 18:76034673-76034695 GAAAACAAGGGGAGGGGGTGAGG - Intergenic
1160182042 18:76644899-76644921 GAGACCAGGGAGAGGGAGAGGGG - Intergenic
1160232292 18:77057558-77057580 GTGAAGAAGGACAAGGAGAGAGG + Intronic
1160705048 19:525767-525789 GAGAAGGAAGAGAAGGAGAGAGG + Intergenic
1160804418 19:985741-985763 GAGAACCAGGAAGAGGAGTCGGG - Intronic
1161195439 19:2983758-2983780 GAGAAGAAGGAGGAGGGATGAGG + Intronic
1161308607 19:3581106-3581128 AAGAAGAAGAAGAAGCAGTGTGG - Intergenic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161734117 19:5979913-5979935 GGGAACAAGGGGAGGGAGGGAGG - Intergenic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1163167526 19:15508372-15508394 GAGAACAAGAAATAGGCGTGTGG - Intergenic
1163574037 19:18099977-18099999 GAGGGCTAGGAGCAGGAGTGGGG + Intronic
1163689233 19:18729845-18729867 AAGAACGAGGATAAGGAGTGTGG - Intronic
1163872009 19:19830097-19830119 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
1163886274 19:19967317-19967339 GAGAGGAAGGAAAAGCAGTGTGG - Intergenic
1163888193 19:19988167-19988189 GAGAAGAAGGAAAAGCAATGTGG + Intergenic
1164249930 19:23467535-23467557 GAGGAGAAGGAGGAGGAGTGGGG - Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164265380 19:23610925-23610947 GAGAACAAGAAAAAGCAGGGTGG - Intronic
1164292166 19:23878693-23878715 GAGAAGGAGGAGGAGGAGTAAGG + Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164515558 19:28932459-28932481 TAGAACCAGGAGATGGAGGGGGG - Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164599661 19:29552419-29552441 GAGAGCAAGGAAAAGCAGGGTGG + Intronic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165281524 19:34802327-34802349 CAGCACAATGAGGAGGAGTGGGG + Intergenic
1165444778 19:35850821-35850843 GGGACCCAGGAGAAGGTGTGGGG - Intronic
1165988755 19:39793417-39793439 GACATCAAGGATAAGGGGTGAGG - Intergenic
1166105234 19:40594910-40594932 TGGAAGAAGGAGCAGGAGTGGGG + Intronic
1166643422 19:44513265-44513287 GAGGACAGGGAGGAGGACTGGGG + Exonic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167259576 19:48450800-48450822 GAGAACACGGTGAGGGAGGGTGG + Exonic
1167415548 19:49369536-49369558 GAGAACCAGGAGAAGGGGAAGGG + Intronic
1167436187 19:49480253-49480275 GTGACCAAGGAGAAGGGCTGGGG - Intronic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
1168673051 19:58255959-58255981 GAGAAAAAGGAAAAGGACTAAGG + Intronic
925060306 2:885581-885603 GAGAAGACTGAGAAGGACTGGGG + Intergenic
925146632 2:1587070-1587092 GAAAACAAGGAGAAGGAATGTGG + Intergenic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926189232 2:10715394-10715416 GAGAAAGAAGAGAAGGAGTGTGG - Intergenic
926376683 2:12236151-12236173 GAGAATAAGGAGAGAGAGAGAGG - Intergenic
926453772 2:13039932-13039954 GAGAGCGAGGAAAAGGAGGGTGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926542401 2:14197542-14197564 GAGGGCAGAGAGAAGGAGTGAGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
927187353 2:20491313-20491335 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
927287292 2:21369908-21369930 GGGAACAAGGAAATGAAGTGAGG - Intergenic
927659517 2:24981048-24981070 GAGAAGAAGGAGGGGGAGGGGGG + Intergenic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928379494 2:30805356-30805378 GAGAAAAAGGGGAAGCAGTGAGG - Intronic
928471785 2:31582154-31582176 GTGAAAAATGAGAAGGACTGGGG - Intergenic
930145228 2:47995567-47995589 GATAACAAGGGGAGGGACTGGGG + Intergenic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
931429676 2:62197867-62197889 AAGAACCAGGAGCAGGAGTTAGG - Intronic
931813948 2:65881679-65881701 GAGAAGCAAGAAAAGGAGTGAGG + Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932094061 2:68831381-68831403 GAGAACAGAGAGAAGGAAGGAGG - Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932376253 2:71238605-71238627 GAGAACAAGGAGTGGCAGAGGGG + Intergenic
932923833 2:75947160-75947182 GAGAACCAGGAAAGGTAGTGGGG + Intergenic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933129391 2:78654683-78654705 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
933855634 2:86411577-86411599 GATAACAGGGAGAAGGAGCTAGG - Intergenic
934037460 2:88100060-88100082 GAAAACAAGGAGGAAGAGGGGGG - Intronic
934542856 2:95190779-95190801 GCGCCCAAGGAGAAGGACTGAGG + Intergenic
936351533 2:111716436-111716458 GAGAAAATGGAGAAAGAGAGGGG + Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936469799 2:112788933-112788955 GAGAGGAGGGGGAAGGAGTGAGG + Intergenic
936541826 2:113358478-113358500 GAGAACTAGGGGTAGGGGTGAGG - Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
936837560 2:116726796-116726818 GAAAACAAGAATAAAGAGTGCGG + Intergenic
936978229 2:118240256-118240278 GGGATCAAGGAGGAGGACTGGGG + Intergenic
937206351 2:120239315-120239337 GAGGGCAGGGAGGAGGAGTGTGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937590915 2:123612182-123612204 GAGAACAAGAAGAAGGCTAGGGG - Intergenic
937735019 2:125277777-125277799 GAGACCAGGGAGAGGGAGAGGGG + Intergenic
937964393 2:127491388-127491410 GAGAGCATGGAGAAAGAGAGGGG - Intronic
938947754 2:136228415-136228437 GAAAAAAAGGAGGAGGCGTGAGG + Intergenic
939513758 2:143140808-143140830 GAGAACAAGGTGCAGCAGAGGGG + Intronic
940057250 2:149525981-149526003 GAGAACAAAGAAAAGCAGGGTGG - Intergenic
940076851 2:149751413-149751435 CTGAACAAGGAGTTGGAGTGGGG - Intergenic
940124774 2:150311163-150311185 GAGAACTAGCAGAAGCAGGGTGG + Intergenic
940613285 2:156018159-156018181 GAAAACAAGGAGAAGTTGTTTGG - Intergenic
940904970 2:159160922-159160944 GAGAGGAAGGAAAAGGGGTGGGG - Intronic
941250153 2:163151484-163151506 GTGAACAAGGAGGAGGATTTTGG - Intergenic
941324607 2:164098180-164098202 GAGAACCTGTAGGAGGAGTGTGG + Intergenic
941884829 2:170517127-170517149 AAGAACAGGGAGAAGGATTTGGG - Intronic
942065846 2:172270703-172270725 GAGGGCAAGCAGAAGCAGTGTGG - Intergenic
942398291 2:175575294-175575316 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
942518991 2:176783355-176783377 GGGAACAGGGAGGTGGAGTGGGG - Intergenic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
942853807 2:180522584-180522606 TAGAACATGCAGAAGGAATGAGG - Intergenic
942947078 2:181683417-181683439 GAAAATAAGGAGGAGGAGCGGGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943731717 2:191309188-191309210 GAGAAAGAGAAGAGGGAGTGGGG - Intronic
943905837 2:193500762-193500784 GAGAACTAGAATTAGGAGTGAGG + Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944289922 2:197993597-197993619 GGGGACAAGGAGAAGGCATGAGG + Intronic
944425702 2:199580497-199580519 GAGAGCAAGGAGAAGGCTAGTGG - Intergenic
944635152 2:201668875-201668897 GAGAAGAAGGTGAGGGAGAGAGG - Intronic
945024414 2:205606398-205606420 GAGAGCAAGGAAAAGCAGGGTGG - Intronic
945085704 2:206129951-206129973 AAAAAAAAGGAGGAGGAGTGGGG + Intronic
945155165 2:206830429-206830451 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
945767220 2:213995952-213995974 AAGGACAAGGAGAAAGAGTGAGG - Intronic
945987531 2:216367312-216367334 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
946426687 2:219602201-219602223 GGGAACACAGAGAGGGAGTGAGG - Intronic
947377733 2:229513884-229513906 GAGGACAGGGAGAGGGAGGGAGG - Intronic
947430331 2:230022244-230022266 GAGAACAAGGGGAAGCAGCGAGG - Intergenic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
947448537 2:230183484-230183506 GAGAAGAAGGAGAGGGCGGGTGG + Intronic
947479240 2:230482435-230482457 GATCACAAGGATTAGGAGTGAGG - Intronic
947736206 2:232456737-232456759 GGGATCAAGGATATGGAGTGTGG + Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948033136 2:234836088-234836110 GAGAACAAGAGGAAAGAGGGTGG - Intergenic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948590712 2:239047855-239047877 GAGAACAAGGCCAAAGAGAGAGG - Intergenic
948676268 2:239598661-239598683 GAGAACACTGGGAAGGAGGGAGG - Intergenic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
948867122 2:240781838-240781860 AAGAACTGGGAGAAGGCGTGTGG - Intronic
1168910652 20:1444150-1444172 GAGAACGAGGGGAAAGAGGGTGG - Intronic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169758490 20:9067827-9067849 GAGAAGGAGGAGGCGGAGTGGGG + Intergenic
1170051496 20:12150538-12150560 GAGAAGAAGGAGAATCAGTAGGG + Intergenic
1170117136 20:12872618-12872640 GAGAACAGGGAAAAATAGTGAGG - Intergenic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170517766 20:17149413-17149435 GAGAGCCAGGAGAAGCAGTGTGG + Intergenic
1170743943 20:19081688-19081710 GAGAACAAGGGTAGGGAGTAAGG - Intergenic
1170803201 20:19607382-19607404 AAGACCAAGGATGAGGAGTGGGG - Intronic
1170848188 20:19980205-19980227 GAGAAAAAGAAGAAAGATTGTGG + Intronic
1171069977 20:22059124-22059146 GAGCACAAGGACAAGAAGGGTGG - Intergenic
1171095917 20:22332181-22332203 GAGAAAAAAAAGAAGGACTGAGG - Intergenic
1171169730 20:23005094-23005116 AAGAACAATGAGAAGGATTAGGG + Intergenic
1171486390 20:25489460-25489482 GGGAGTAAGGAGAAGGAGGGGGG - Intronic
1171849689 20:30299622-30299644 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1172227035 20:33311953-33311975 GAGAAGAAGGAGGTGGTGTGGGG - Intergenic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1172773157 20:37393100-37393122 GAAAGTGAGGAGAAGGAGTGGGG - Intronic
1172780258 20:37432619-37432641 GGGAACAAGGAAGGGGAGTGGGG - Intergenic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173337490 20:42124656-42124678 GAGACCAGGGTGATGGAGTGAGG + Intronic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1174001489 20:47378228-47378250 AAGATCAAGGAGGAGGCGTGGGG + Intergenic
1174008895 20:47433031-47433053 GAGAAAGAGAAGAGGGAGTGAGG + Intergenic
1174462400 20:50691906-50691928 GAGGGAAAGGAGAAAGAGTGAGG - Intergenic
1174483999 20:50850083-50850105 GAGACCAGGGAGAAGTAGAGCGG + Intronic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174992236 20:55523242-55523264 GAGAACAAGGAAAAGCACAGTGG + Intergenic
1175072383 20:56345345-56345367 GAGAACATGGAGAAGCTGAGTGG + Intergenic
1175170517 20:57077106-57077128 GACAACAAAGCCAAGGAGTGTGG + Intergenic
1175725429 20:61315102-61315124 GAGCCCAAGGAGGAGGAGTCTGG - Intronic
1175762126 20:61568358-61568380 GGCAGCAAGGAGAATGAGTGTGG - Intronic
1175921265 20:62451540-62451562 GAGAAGAGAGAGAAGGAGAGAGG + Intergenic
1176057159 20:63154877-63154899 GAGAAGAGGGAGAAGGGGAGAGG - Intergenic
1176326775 21:5508299-5508321 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176400982 21:6312652-6312674 GAGACTAAGGAGAGAGAGTGGGG - Intergenic
1176436175 21:6676452-6676474 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176460437 21:7003522-7003544 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176483998 21:7385300-7385322 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1177219955 21:18179665-18179687 AAGTACAAGGAAAAGGAGAGTGG - Intronic
1177444676 21:21177709-21177731 GGGAAAAAAGAGAAGGAGAGGGG - Intronic
1177927509 21:27236576-27236598 GAGAAGAAAGTGAAGAAGTGTGG - Intergenic
1178930558 21:36814922-36814944 GAGAAGCAGGTGGAGGAGTGGGG + Intronic
1179677806 21:42996288-42996310 GAGACCTAGGAGCAGGAGTGGGG + Intronic
1179789572 21:43748703-43748725 GAGAAGGAGGTGAAGGAGAGAGG - Intronic
1179988622 21:44934249-44934271 AAGAACATGGAGGAGGAATGTGG - Intronic
1180784397 22:18538828-18538850 GAGAACCCAGAGATGGAGTGAGG + Intergenic
1180798377 22:18619238-18619260 GAGCTGAAGGAGAGGGAGTGAGG + Intergenic
1180836246 22:18930984-18931006 GAGCACAAGGAGATGGAGTAAGG - Exonic
1181223341 22:21376027-21376049 GAGCTGAAGGAGAGGGAGTGAGG - Intergenic
1181255399 22:21559599-21559621 GAGCTGAAGGAGAGGGAGTGAGG + Intronic
1181327496 22:22061087-22061109 GACAATGAGGAGGAGGAGTGGGG - Intergenic
1181484388 22:23221382-23221404 GGGAACAGGGTGAAGGAGGGAGG - Intronic
1181517252 22:23422080-23422102 GAGCAAAAGGAAGAGGAGTGGGG - Intergenic
1181817198 22:25447517-25447539 GAGAAAAAGCAGCAGTAGTGTGG - Intergenic
1181977208 22:26738467-26738489 GAGAACAAGGAGGAGGGGAAGGG - Intergenic
1182058579 22:27380475-27380497 TAGAACAAGGGCAAAGAGTGGGG + Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182308531 22:29388381-29388403 GCGAGCCAGGAGAAGAAGTGGGG - Intronic
1182420504 22:30246401-30246423 GAGGAGGAGGAGAAGGAGAGGGG + Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182931478 22:34178308-34178330 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183313544 22:37124754-37124776 GAGAAAAAGGAGGAGAGGTGGGG - Intergenic
1183675394 22:39296457-39296479 GAGGCCAAGGAGAAGGGGAGAGG - Intergenic
1184053850 22:42030831-42030853 GAGAACAGGGTGAATGGGTGAGG + Intronic
1184444870 22:44541174-44541196 GGGAGGAAGGAGTAGGAGTGAGG - Intergenic
1184449735 22:44575846-44575868 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184449765 22:44575980-44576002 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184542052 22:45132623-45132645 GGGAAGAAGGAGAAGCAGAGAGG + Intergenic
1184723977 22:46332388-46332410 GTGTACCAGGAGAGGGAGTGGGG - Intronic
1184883682 22:47328828-47328850 GAGAAAAAGGAAAAGGAAAGAGG - Intergenic
1185037056 22:48484875-48484897 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1203286338 22_KI270734v1_random:156283-156305 GAGCACAAGGAGATGGAGTAAGG - Intergenic
949141529 3:639387-639409 GGGAATAAGGAAAAGGAGTGTGG - Intergenic
949179885 3:1116180-1116202 GTCAACAAGGAGAAGGATTAAGG + Intronic
949420018 3:3855816-3855838 GAGAACAAGAAGTAGGGATGTGG - Intronic
949494615 3:4619837-4619859 GAGAAAAGAGAGAAGGAGAGGGG - Intronic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949813768 3:8036960-8036982 GAGAACATGGAGGAAGAATGGGG - Intergenic
950002090 3:9664766-9664788 AGGAACAAGGGGGAGGAGTGGGG + Intronic
950394016 3:12719684-12719706 GAGACAGAGGAGAAGGAGAGAGG + Intergenic
950584764 3:13884223-13884245 GAGACCAAGAAGGATGAGTGGGG + Intergenic
950918300 3:16667490-16667512 GAGAAAAGAGAGCAGGAGTGGGG + Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952503890 3:33989735-33989757 GAGAAGAAGGAAGAGCAGTGTGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952786769 3:37163447-37163469 GAGGACAAAGAGAGGGACTGTGG - Intronic
953115717 3:39990269-39990291 GAGAAGAAGGAAGAGTAGTGTGG - Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953453432 3:43022710-43022732 AAGGGCAATGAGAAGGAGTGGGG + Intronic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955176383 3:56618310-56618332 GAGAACAATCAGAAAGGGTGTGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955476308 3:59340048-59340070 GAGAACAAGAAGAAGAGATGTGG + Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955599960 3:60634699-60634721 GAGAAAGAGGAGAAGAAGTTTGG + Intronic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
955699989 3:61672760-61672782 GAGAAGAGGGAGAGGGAGAGAGG + Intronic
955756819 3:62233345-62233367 GAGAGCATGGGGAAGGAGAGGGG - Intronic
956008140 3:64802318-64802340 TAGGACAAGGAGAGGGAGAGAGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956671284 3:71693396-71693418 GAGAACAAGACGAAGGGGTTAGG + Intronic
957227372 3:77467361-77467383 GAGAAAAATGAGAAGCAGTAGGG + Intronic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958482021 3:94654630-94654652 GAGAGCAAGGAAGAGCAGTGCGG - Intergenic
958821904 3:98984634-98984656 GAGAACAAGGAGAAGAGGCAGGG - Intergenic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
959166965 3:102792512-102792534 AAGAAAAAGAAGGAGGAGTGAGG + Intergenic
959554285 3:107698961-107698983 GTGAACAAGGAAAAGGACTATGG + Intronic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960134733 3:114093890-114093912 GAGGACAAGGAGGAGGTGAGGGG - Intergenic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960806207 3:121586138-121586160 GAGAAAAAGCATAAGGACTGGGG - Exonic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
962491412 3:135897239-135897261 GAGAAGCAGGAGGAGGAGAGGGG - Intergenic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
962653580 3:137519837-137519859 GAGAATAATGCGAAGGAGAGAGG + Intergenic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
962958332 3:140286785-140286807 TAGAAGAAGGAGGAGTAGTGGGG + Intronic
963327347 3:143877129-143877151 GAGGAAAAGGAGAAGGTGTGGGG - Intergenic
963543550 3:146625983-146626005 GCCAATAAGGAGGAGGAGTGTGG - Intergenic
963728774 3:148950371-148950393 GAGAACATGGATGAGGAATGAGG - Intergenic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965253290 3:166369511-166369533 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965802754 3:172511527-172511549 GAGAACACAGAGAAGGAGAATGG + Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966483725 3:180444311-180444333 GAAAACAAGCAAAAGGTGTGGGG - Intergenic
966507482 3:180723016-180723038 GAGAACAGGGAAAAGGAATTAGG - Intronic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967316143 3:188153844-188153866 GAGACCAAGGGGAGGGGGTGGGG + Intronic
967390581 3:188950265-188950287 GAGAAGAAGGGGTAGGATTGTGG - Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968876535 4:3270586-3270608 AAGGACAAGAGGAAGGAGTGAGG - Intronic
968938364 4:3625125-3625147 AAGGACAAGGAGAAGCAGTGTGG + Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969510130 4:7612899-7612921 GGGAACAAGAAGAAGGGCTGGGG + Intronic
969702288 4:8774174-8774196 TAATAGAAGGAGAAGGAGTGGGG - Intergenic
969916755 4:10498977-10498999 GAGAAAAAGGACAAGGGTTGGGG - Intronic
970129043 4:12846074-12846096 GAAAACAAGCTGAAGGAATGTGG - Intergenic
970356268 4:15256293-15256315 CAGGTCAAGGAGAAGGAATGAGG - Intergenic
970423273 4:15924498-15924520 GAAACCAAGCAGAAGCAGTGCGG - Intergenic
970500598 4:16672899-16672921 GAGAAAAAAGATAAGGAGAGGGG - Intronic
970903312 4:21185482-21185504 GAGAAAAAGGAGAAGAGGAGGGG - Intronic
971084470 4:23255782-23255804 GATCACAAGGAGAAGAAGAGTGG - Intergenic
971175498 4:24278654-24278676 GAGAAGAAAGGGAAGGAGTTGGG - Intergenic
971372934 4:26032814-26032836 GAGAACAATTAGGACGAGTGTGG + Intergenic
971388166 4:26160692-26160714 GAGTAAAAGGAGAAAGAGTGTGG + Intergenic
972158753 4:36197943-36197965 GAAAACAAGGAGAAGAGCTGCGG - Intronic
972377507 4:38486299-38486321 GAGAGAGAGGAAAAGGAGTGAGG + Intergenic
972798591 4:42448379-42448401 GAAAAGAAAGAGAAGGAGGGAGG - Intronic
972860902 4:43168657-43168679 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
973234082 4:47878388-47878410 GAAAAGAAGGAGAAGGGATGAGG + Intronic
973321707 4:48817134-48817156 GAGAGTAAGCAGAAGCAGTGTGG + Intronic
973588352 4:52414441-52414463 GAGAACAAGAGTGAGGAGTGAGG + Intergenic
973666549 4:53165061-53165083 GGGAACAAGGAGAGTGAGTTAGG - Intronic
973833774 4:54789102-54789124 GAGAAGGAGGGGAAGGAGAGAGG - Intergenic
974406606 4:61480174-61480196 GAGAAGGAGGAGATGGAGAGAGG - Intronic
974499600 4:62683691-62683713 GAGATCAAGGAAAAGCAGGGTGG + Intergenic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
975050544 4:69858753-69858775 GAGACTAAGGAGAAGGCTTGGGG - Intronic
975990576 4:80256086-80256108 GAAAAAAAGGAGAAGCAGTAGGG - Intergenic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976375576 4:84342025-84342047 GAGACCAAGGAAAAGCAGGGTGG + Intergenic
976379122 4:84379446-84379468 TCGAACAAGAAGATGGAGTGGGG + Intergenic
977009468 4:91618551-91618573 GAGAAAAGGGAGAAGAAGAGTGG + Intergenic
977033270 4:91915712-91915734 GAGATCATGTAGAAGGAGGGAGG + Intergenic
977039729 4:92001637-92001659 GAGAGCAAGAAGAAGCAGGGTGG + Intergenic
977066932 4:92329965-92329987 GAGAAAAAGGAAGAGGAGTATGG + Intronic
977318240 4:95478308-95478330 AAGAATAAGGACAAGGATTGGGG + Intronic
978421972 4:108542664-108542686 GTGAAAAAGGAGAGAGAGTGGGG - Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979022949 4:115525565-115525587 GAGAGCAAGTAGAAGCAGGGTGG - Intergenic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
980184551 4:129445961-129445983 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
980333758 4:131441645-131441667 GAGAACAAAGAAAAGTAGGGTGG - Intergenic
980924296 4:139119354-139119376 GAGAGCAAGGTGAAGAAGGGTGG - Intronic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981172724 4:141643569-141643591 GAAAATAAGGAGAAGGGGAGTGG - Intronic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981741703 4:148009115-148009137 GAGAAAAAAGAGAAGTATTGAGG - Intronic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
983753175 4:171301677-171301699 GGTAACAATGAGAAGCAGTGGGG + Intergenic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984061533 4:174993747-174993769 GACTAGAAGGGGAAGGAGTGAGG + Intergenic
984578460 4:181479389-181479411 GAAAACTAGGAGAAGGATTTTGG + Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985781582 5:1874445-1874467 GAGAAAGAGGAGAGGGAGAGAGG + Intergenic
985862141 5:2479539-2479561 GGGAAGAATGAGAGGGAGTGTGG + Intergenic
986009681 5:3700900-3700922 GAAAAGAAGAAGAAGGAGGGAGG - Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986091905 5:4516942-4516964 AAGAAGGAAGAGAAGGAGTGGGG - Intergenic
986183053 5:5411550-5411572 AAAAAAAAGAAGAAGGAGTGAGG - Intergenic
986200116 5:5572024-5572046 GAGAACCAGGAGAAGAAGCATGG - Intergenic
986221740 5:5774798-5774820 GAGAAAGGGGAGGAGGAGTGGGG - Intergenic
986623180 5:9697066-9697088 GAGGACGAGGAGAAGGAGAAAGG + Intronic
986768539 5:10950191-10950213 GAGAACCAGGAGAAGCTGTGAGG - Intergenic
986996405 5:13612258-13612280 GGGAACAAGAACAAGGAGTCAGG + Intergenic
987043477 5:14085104-14085126 GAGGACAATGAGAAGGAAGGAGG - Intergenic
987203231 5:15598764-15598786 GAAGACAAGGAGGGGGAGTGAGG - Intronic
987303819 5:16619151-16619173 GAGAACATGGGGCAGGAGAGAGG + Intergenic
987419776 5:17705655-17705677 GACAACGTGGAGAAGAAGTGAGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989160249 5:38384117-38384139 GAGAGGAAGGAGAAGGAATAAGG + Intronic
989311910 5:40028979-40029001 GAAGAAAAGGAGAAGGAGAGGGG - Intergenic
990231050 5:53712981-53713003 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
990461812 5:56037731-56037753 GAAAACAAGGGGAAGGAAGGTGG - Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990597900 5:57329633-57329655 GGGAAGAAGGAGAAGGGGCGAGG + Intergenic
990940831 5:61201094-61201116 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991200494 5:63986311-63986333 GATCTCAAGGAGCAGGAGTGAGG + Intergenic
991371646 5:65925827-65925849 GAGAGAAAGGAGGAGGAATGGGG - Intergenic
991609052 5:68431870-68431892 GAGAACTCTGAGAAGGAGGGGGG + Intergenic
991965134 5:72083266-72083288 GAGGAAAAGGAGAAGCAGAGAGG - Intergenic
991990225 5:72330867-72330889 GAGAACAAGGGAAAGAAGTGGGG - Intronic
992595717 5:78345452-78345474 GAGAACAGAGAGAAGGGGTTAGG - Intergenic
992623443 5:78616016-78616038 GAGGACAAGAGGGAGGAGTGTGG - Intronic
992678182 5:79126763-79126785 GAGACCAAGCAGATGAAGTGAGG + Intronic
992874880 5:81044024-81044046 GAGAATGAGGAGAGGGATTGGGG + Intronic
993132038 5:83911101-83911123 AAGAAACAGGAGATGGAGTGAGG - Intergenic
993191051 5:84681944-84681966 GAGAACAAGGATCAGTAATGTGG - Intergenic
993378133 5:87174234-87174256 GAGAAAGAGGAGAAAGACTGTGG - Intergenic
994171015 5:96660191-96660213 GAACAGAAGGAGAAGGGGTGGGG - Intronic
994350610 5:98742233-98742255 GAGAGCAAGGAAAAGAAGAGTGG + Intergenic
994691908 5:103030130-103030152 GAGGCCAAGCAGAAGGATTGTGG + Intronic
995177553 5:109196266-109196288 GAGATGATGGAGTAGGAGTGGGG + Exonic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995649892 5:114358684-114358706 GAGTACAGAGAGAAGGAGAGAGG - Intergenic
995677974 5:114684835-114684857 TAGAACAAGGAATAGGACTGAGG + Intergenic
996156319 5:120107175-120107197 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
996638962 5:125729982-125730004 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
998206364 5:140159543-140159565 GAAAAGAAGGGGATGGAGTGAGG - Intergenic
998534482 5:142916793-142916815 GTGAAAATGGAGGAGGAGTGAGG + Intronic
998566011 5:143216471-143216493 GAGAACATGAAGAAGGCATGAGG - Intronic
998651769 5:144128564-144128586 CATCACTAGGAGAAGGAGTGAGG + Intergenic
998977002 5:147659328-147659350 GAGAACCAGCAGAAGCAGGGTGG - Intronic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
999237343 5:150106785-150106807 TGGAACAGGAAGAAGGAGTGTGG - Intronic
999628319 5:153543590-153543612 AGGAAGAAAGAGAAGGAGTGAGG + Intronic
999863094 5:155669400-155669422 GAGACAAAGCAGAAGGAGAGGGG + Intergenic
999936739 5:156494839-156494861 GAGTACAGGGAGAATGAGTATGG - Intronic
1000126010 5:158244888-158244910 AAGAACAATGGGAAGGGGTGAGG - Intergenic
1000256463 5:159543412-159543434 GAAAATAAAGAGAAGGAGTGGGG + Intergenic
1000482496 5:161796630-161796652 GAAAAAAAGGAAAATGAGTGTGG + Intergenic
1000963663 5:167629880-167629902 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1001018469 5:168162736-168162758 GATAACAAGGATAATGAGGGAGG + Exonic
1001241944 5:170077891-170077913 GAGAAGAGAGAGAAGGAGGGGGG - Intronic
1002461334 5:179375446-179375468 AAGCACAAGGAGGGGGAGTGTGG - Intergenic
1002701800 5:181129963-181129985 GAGAACGAGAAGAAAGAGTGAGG + Intergenic
1002806085 6:575452-575474 GAGAGGATGGAGAGGGAGTGAGG - Intronic
1002847780 6:963307-963329 GAGAAGATGGAAAAGGAGAGAGG + Intergenic
1002899508 6:1399259-1399281 GAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1003139250 6:3457087-3457109 GAGGAGGAGGAGGAGGAGTGGGG - Intergenic
1003331651 6:5134853-5134875 GAGAGGAAGGAGAAGGAATAGGG - Intronic
1003382875 6:5640822-5640844 AAGAAAAGGGACAAGGAGTGGGG - Intronic
1003425639 6:5996619-5996641 GAGAACCAGGATAAAGAGGGAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003902613 6:10668796-10668818 GAGAACAAAGAAAAGAAGGGTGG - Intergenic
1004278499 6:14258885-14258907 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1004411597 6:15386241-15386263 AAGAACAGGGAGAGGGAGAGGGG - Intronic
1004427462 6:15516179-15516201 GAGAACACGTTGTAGGAGTGTGG - Intronic
1004725623 6:18308803-18308825 GGGAAGAAAGAGAAGGAGAGAGG - Intergenic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1005850767 6:29819055-29819077 GAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1006053185 6:31359285-31359307 GAGGACAAGGAGCAGGAGAAAGG - Intergenic
1006094680 6:31648623-31648645 GAGAAAAGGGAGAGGGAGGGTGG + Intronic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007159550 6:39777959-39777981 GAGAACATGGAGAAGGTCTCAGG - Intergenic
1007354895 6:41307164-41307186 GAAAACATGGAGAAAGAGAGTGG - Intergenic
1007427943 6:41759362-41759384 GAGAACAAGGCAAAGGAGCATGG - Intergenic
1007564830 6:42841892-42841914 GAGAAAAATGGGAAGCAGTGTGG - Intronic
1007877068 6:45116210-45116232 GAGAAGAAGGAGAGGAAGGGAGG - Intronic
1008065540 6:47043857-47043879 GAAAACAAGCAGAAGGAGAATGG - Intergenic
1008373795 6:50768307-50768329 GAGAAAAAAGAAAAGGAGAGAGG - Intronic
1008584797 6:52938734-52938756 GAGAAGAAGAAGAATGAATGGGG + Intergenic
1008753446 6:54764983-54765005 GAGAAAAAGCAGAAGGACAGAGG - Intergenic
1009672351 6:66772550-66772572 GAGAAAAAGGTGAAAGAGAGAGG - Intergenic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1010356001 6:74934351-74934373 GTGAACTAGTAGAAAGAGTGAGG + Intergenic
1010662285 6:78585177-78585199 GAGAAGAATGATAAGCAGTGAGG - Intergenic
1011065417 6:83320999-83321021 GAGGGCAAGGAGAAGCAGGGTGG + Intronic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1011743005 6:90382000-90382022 GAGAAAATAGAGAAGGTGTGAGG + Intergenic
1011803327 6:91043322-91043344 GAGGACAAGGTCTAGGAGTGAGG + Intergenic
1012011532 6:93792796-93792818 TAGAAGAAGAAGAAGCAGTGTGG + Intergenic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012695332 6:102374679-102374701 GAGTAGAAGGAGAAAGATTGGGG - Intergenic
1012832242 6:104218874-104218896 GATAACAATGAGAAGAACTGGGG + Intergenic
1012890220 6:104888516-104888538 GAGAACAAAAGGAAGGACTGGGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013420040 6:109959246-109959268 GAAAACAAGGAGAGGGACTGTGG - Intergenic
1013550721 6:111205190-111205212 GAGAAAAAGGAGATGGTGTTGGG + Intronic
1013835694 6:114332779-114332801 GAAAACAAAGAGAGGTAGTGTGG + Intronic
1014154923 6:118099458-118099480 GGGGAGGAGGAGAAGGAGTGGGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014827550 6:126063891-126063913 GAGATCTAGGAGCAAGAGTGAGG + Intergenic
1014997242 6:128164064-128164086 GAAGAAAATGAGAAGGAGTGAGG - Intronic
1015064775 6:129011206-129011228 GAGCAAAAAGAGAAGGAGAGAGG - Intronic
1016003685 6:139067771-139067793 GAGGAGAAGGAGGAGGAGAGGGG - Intergenic
1016062524 6:139645570-139645592 GAGAACCTGGGAAAGGAGTGAGG + Intergenic
1016209739 6:141515906-141515928 GAGAACAAAGAGAGGGTTTGGGG - Intergenic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017952856 6:159151128-159151150 GAGAACAATTAGAGGGATTGGGG - Intergenic
1018178541 6:161200025-161200047 GGCAACAAGGGGAAGGAGAGAGG + Intronic
1018256213 6:161922219-161922241 TAGAACAAGGAAGAGAAGTGAGG - Intronic
1018799725 6:167212516-167212538 GAAAACAAGGAGGAGGAATGGGG + Intergenic
1018911401 6:168102341-168102363 GAGAGCAAAGAGAGGGAGAGAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019535285 7:1526144-1526166 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019535309 7:1526231-1526253 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019805054 7:3117575-3117597 GAGAAAGAGGAGAGGGAGGGAGG + Intergenic
1020066485 7:5191675-5191697 GTGAGGAAAGAGAAGGAGTGGGG + Intronic
1020594178 7:10183507-10183529 TAGAGCAAGGAGAATGATTGTGG + Intergenic
1020779159 7:12496439-12496461 GAGAAGAAGGGAAAGGAGTTTGG - Intergenic
1020929858 7:14379463-14379485 GAGAATAAGGAAAGAGAGTGGGG + Intronic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021923763 7:25514705-25514727 GAGAGTAAGGAGAATGAGTTTGG - Intergenic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022256152 7:28660700-28660722 GAGGAAAAGGTGAAGGGGTGGGG - Intronic
1022553996 7:31273185-31273207 GACAAGAAGGATAAGGAGTGGGG - Intergenic
1022723730 7:32962859-32962881 GAGAAAAAGCAGTAGGAGTGAGG + Intronic
1022901173 7:34811965-34811987 GAGAAGAAAGAGAAGGAAAGAGG - Intronic
1023085770 7:36568737-36568759 GAGAAGAAAGAGAAGGGGAGGGG - Intronic
1023088646 7:36597621-36597643 GAGAAAAAGGTGAGGGAGTGGGG - Intronic
1023655928 7:42420831-42420853 GAGAAAGAGGAGAAAGAGGGAGG + Intergenic
1023713737 7:43022011-43022033 GAGAGCAAAGAAAAGGCGTGAGG - Intergenic
1024034474 7:45495579-45495601 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1024122917 7:46263273-46263295 GATAACAGAGAGAAGAAGTGAGG - Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024569083 7:50709481-50709503 GCCAGCAAGGAGAGGGAGTGAGG - Intronic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024848177 7:53675959-53675981 GATTACAAGGGGCAGGAGTGGGG - Intergenic
1024896997 7:54271846-54271868 GAGAACAAGGAGCTAAAGTGTGG + Intergenic
1025049894 7:55725056-55725078 GAGAAAAAGCAGTAGGAGTGAGG - Intergenic
1025147085 7:56514297-56514319 GGGAAGGAGGGGAAGGAGTGAGG - Intergenic
1025147092 7:56514318-56514340 GGGAAGGAGGGGAAGGAGTGAGG - Intergenic
1025288171 7:57685618-57685640 GAGACCAAGGAGCAGGAGCATGG + Intergenic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026309317 7:69170127-69170149 GAGAACTCGGAGAAGGGATGTGG + Intergenic
1026600522 7:71773759-71773781 GAGAACCAGGGGAAGGAGGATGG + Intergenic
1026679033 7:72451378-72451400 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1026777142 7:73237602-73237624 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1026955052 7:74371751-74371773 GAGAGGGAGGAGAAGGAGAGAGG + Intronic
1027017988 7:74790974-74790996 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027070036 7:75154953-75154975 CTGAACAAGCAGAAGGGGTGAGG + Intergenic
1027602847 7:80260508-80260530 GTGAATAGGAAGAAGGAGTGTGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1028131286 7:87176917-87176939 AAGAAAAAGGGCAAGGAGTGTGG + Intronic
1028508850 7:91599457-91599479 GAAAACAAGGAGAAGGCTTTAGG + Intergenic
1028627141 7:92889677-92889699 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1028636298 7:92993434-92993456 GAGAACAAGAAGAAAGGGAGGGG + Intergenic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1028651669 7:93156932-93156954 GAGCCCAAGGAAAAGTAGTGGGG - Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029495546 7:100894167-100894189 GAGGAGGAGGAGAAGGAGTGGGG + Exonic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1030082504 7:105789748-105789770 AAGAACAATGAGAAGTACTGGGG + Intronic
1030153585 7:106429340-106429362 GATCCCAAGGAGTAGGAGTGAGG - Intergenic
1030168623 7:106579515-106579537 GAGAAAAAAGAGTAAGAGTGAGG + Intergenic
1030207696 7:106966820-106966842 GAGAAGCAGGGGATGGAGTGGGG + Intergenic
1030397289 7:109002932-109002954 GAGGAGAAGAAGAAGCAGTGAGG - Intergenic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030692279 7:112547605-112547627 GAGAACGAGGAAAAGCAGAGTGG - Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031214842 7:118877207-118877229 GGGAAGAAGGAGAAGGGGAGGGG + Intergenic
1031563961 7:123271440-123271462 GACAACAAGGGTAAGAAGTGAGG + Intergenic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1031949362 7:127876117-127876139 AAGGACAAAGAGAAGGAGAGGGG - Intronic
1031990204 7:128192651-128192673 GAGGACAAGGGGAAGAAGAGGGG - Intergenic
1032455865 7:132072965-132072987 GAGAACAAGGTCTAGGAGTGGGG - Intergenic
1032470256 7:132173252-132173274 GAGAAAAATGAGTAGGACTGGGG + Intronic
1033356872 7:140607282-140607304 GGGAACAAGGAGAGGAAGGGAGG + Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033475829 7:141691469-141691491 GAGAACCAGGCTAAGGAATGGGG - Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034275844 7:149823532-149823554 AAGAAGGAGGAGCAGGAGTGTGG - Intergenic
1034537922 7:151737582-151737604 GAAAACAAGGGGATGGAGTGTGG + Intronic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1034894281 7:154865806-154865828 GGGAACAAGGAGAAAGACTTGGG + Intronic
1036182662 8:6598439-6598461 GAGAAGAAGGGGATGGGGTGGGG + Intronic
1036777251 8:11622109-11622131 AAGAAGAAGAAGAAGAAGTGAGG - Intergenic
1036899477 8:12660017-12660039 GAGGCCAAGGAGAAGGGCTGGGG + Intergenic
1036987982 8:13557930-13557952 AAGAACAAGGAGAAGGTTGGAGG + Intergenic
1037249662 8:16877457-16877479 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037300247 8:17443993-17444015 GAGGGAAAGGAGGAGGAGTGAGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037608072 8:20454152-20454174 GTGAACAAGGAGACAGAGGGTGG - Intergenic
1038120391 8:24607973-24607995 GAGGAAAAGGAGAAGGGGAGGGG + Intergenic
1038310891 8:26445471-26445493 GAGGACAAGGAGATGAAGCGTGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1039265046 8:35815455-35815477 GAGAGGAAGGAGGAGCAGTGTGG + Intergenic
1039658143 8:39433116-39433138 GAGAAAAAGGAAGAAGAGTGTGG + Intergenic
1039754911 8:40512728-40512750 GAGAACAAGCTGAAGCAGGGTGG - Intergenic
1040287491 8:46107929-46107951 GAGAAAATGGAGCAGCAGTGTGG - Intergenic
1040758416 8:50808603-50808625 GAGAAGACAGAGAAGGAGAGGGG - Intergenic
1040781463 8:51114774-51114796 GAGAGAAGGGAGAAGGAGAGAGG - Intergenic
1041098130 8:54369853-54369875 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041211940 8:55560216-55560238 GAGAAGAAGGAAGAGCAGTGTGG - Intergenic
1041283809 8:56239177-56239199 GAGAACAGGGAGGAGGATTATGG + Intergenic
1041315724 8:56560185-56560207 GAGAACAAGGAGGGAGAGGGAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041728405 8:61039996-61040018 GAGGACTACTAGAAGGAGTGAGG - Intergenic
1041860266 8:62504820-62504842 GAGCAGAAAGAGAAGTAGTGAGG - Intronic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042595745 8:70446227-70446249 GAGAACTGGGAGAAGCAGTAGGG + Intergenic
1042759581 8:72256761-72256783 GAGAGCAAGGAAAAGTAGGGTGG + Intergenic
1042773537 8:72404951-72404973 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1043058797 8:75473979-75474001 GAGAACAAAAAGTAGGAGTTAGG + Intronic
1043295665 8:78659622-78659644 GAGAACAAAAAGAAGGAGAATGG + Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1045048884 8:98304998-98305020 GAGAACCAGGAGAGTCAGTGGGG + Intergenic
1045057212 8:98379561-98379583 GAGCACTTGAAGAAGGAGTGGGG - Intergenic
1045184511 8:99823449-99823471 GAGGAGGAGGAGGAGGAGTGAGG + Intronic
1045545141 8:103121980-103122002 GAGAACAACCAGAGAGAGTGTGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046611530 8:116430907-116430929 GAGAACAAGGTGAATGTGAGTGG - Intergenic
1046768738 8:118098013-118098035 GGGGAGAAGGAGGAGGAGTGTGG + Intronic
1047125127 8:121951515-121951537 GAACCCAATGAGAAGGAGTGTGG - Intergenic
1047391422 8:124454851-124454873 GGGAACAAGGAGAAACAATGAGG + Intronic
1047875767 8:129136093-129136115 GGTAACAAGGATAAGAAGTGGGG - Intergenic
1048282997 8:133119042-133119064 GAGAGCACGGGGAGGGAGTGTGG + Intronic
1049116510 8:140693249-140693271 GGGAACAAGAAAAGGGAGTGTGG + Intronic
1049293565 8:141817501-141817523 GAGATGAAGGAGAAAGGGTGGGG - Intergenic
1049363134 8:142223806-142223828 GAGATCATGGATAAGGAGAGAGG + Intronic
1049405253 8:142449533-142449555 GAGGAGAAGGAGGAGGAGAGAGG - Exonic
1049497707 8:142944262-142944284 GAGAACAATGAGGAAGAGTCTGG - Intergenic
1050126675 9:2363179-2363201 GAGAAGAAAGAAAAGGTGTGAGG + Intergenic
1050923363 9:11233941-11233963 GTGGAGAAGGAGGAGGAGTGGGG + Intergenic
1050984056 9:12059599-12059621 GAGGACAAGGGGGAAGAGTGGGG + Intergenic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051459529 9:17295475-17295497 GAGAGCAAGGAAAAGCAGGGTGG - Intronic
1052337175 9:27331825-27331847 GAGAAAAAGGAGACTGAGTGTGG + Intronic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052864768 9:33458238-33458260 GGGAAGAAGGAGAAGGGGTTAGG + Intergenic
1052961859 9:34305183-34305205 GAGTCCAAGGAGAAAGAGTTTGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053284745 9:36842869-36842891 GAGATGAAGCAGAAGGACTGGGG - Intronic
1053303022 9:36965059-36965081 TGGAGCAAGGAGAAGGGGTGTGG - Intronic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053787464 9:41662914-41662936 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1054157662 9:61651853-61651875 GAGAACATGGTCAAGGAGTTGGG - Intergenic
1054452851 9:65412685-65412707 AAGGACAAGGAGAAGCAGTGTGG - Intergenic
1054477436 9:65582858-65582880 GAGAACATGGTCAAGGAGTTGGG - Intergenic
1055379034 9:75685980-75686002 GAGGAGGAGGAGAAGGAGTTGGG + Intergenic
1055436047 9:76293252-76293274 AAGAAAAAGTAAAAGGAGTGTGG + Intronic
1056306988 9:85300178-85300200 GAACATCAGGAGAAGGAGTGTGG + Intergenic
1056407525 9:86289477-86289499 GAGAAGAAGGATATGGTGTGAGG - Intronic
1056543844 9:87596647-87596669 GAGAGCATGGGAAAGGAGTGAGG - Intronic
1057016622 9:91657862-91657884 GAAAACAAGGAGATGGAGGAGGG - Intronic
1057497373 9:95571852-95571874 GAGAAGGAGGAGGAGGAGAGGGG + Intergenic
1058047597 9:100373406-100373428 GAGAACAAAGGGAAGGAGTGGGG + Intergenic
1059151880 9:111956415-111956437 GAGATCAGGGAGAAGGAGAGAGG - Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059542524 9:115144377-115144399 GAGGAAAAGGAGAAGGGGAGGGG - Intronic
1059671147 9:116493631-116493653 GGAAACAAGGAGGAGGATTGAGG - Intronic
1059796713 9:117705458-117705480 GAGGACAAGGAGGAGGACTATGG - Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060294076 9:122331464-122331486 CAGAACTAGGAGTAGGCGTGAGG - Intergenic
1060431689 9:123556270-123556292 GATAAAAAGGAGTAGGAGGGTGG + Intronic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061613637 9:131764783-131764805 GAGAAGGAGGAGGAGGAGAGAGG - Intergenic
1061959561 9:133981103-133981125 GAGAAGCAGGAGACGGGGTGAGG + Intronic
1061995615 9:134181320-134181342 GAGAGCAGGGAGAGGGGGTGAGG + Intergenic
1062249432 9:135586938-135586960 GAGGACAAGGGGCAGGACTGAGG - Intergenic
1062255831 9:135620123-135620145 GAGAAGGGGGAGAAGGAGTAGGG - Intergenic
1062325540 9:136010835-136010857 CAGAACAAGGACAGGGTGTGGGG + Exonic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1062627611 9:137450361-137450383 GAGATCAAGGGGAAGAAGCGTGG - Intronic
1062627755 9:137450873-137450895 GAGATCAAGGGGAAGAGGTGTGG - Intronic
1062628059 9:137451931-137451953 GAGACCAAGGGGAAGAGGTGTGG - Intronic
1062628104 9:137452088-137452110 GAGACCAAGGGGAAGAGGTGTGG - Intronic
1062628133 9:137452174-137452196 GAGACCAAGGGGAAGAGGTGTGG - Intronic
1062744694 9:138203728-138203750 GACAAGGGGGAGAAGGAGTGGGG + Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185787482 X:2903110-2903132 GAGAAAAAGAAGAAGGAGAAGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186965173 X:14779185-14779207 GAGAAAATGGTGAAGGAGTTAGG - Intergenic
1187248892 X:17579474-17579496 GATAAAAAGGAGAGGGAGAGGGG - Intronic
1187259546 X:17672594-17672616 GACACCAAGGAGAGGGAGTGAGG - Intronic
1187476150 X:19612860-19612882 GAGAACAAGGACAAGAACTGAGG + Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187645994 X:21348147-21348169 GAGAACAAAGAAAAGCAGGGTGG + Intergenic
1187865038 X:23716178-23716200 GAGCACAGGGAGAAAGAATGTGG + Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188139391 X:26529723-26529745 GAGAACTAGAATTAGGAGTGAGG + Intergenic
1188472968 X:30560833-30560855 GAGCACAAGCAGAAGGAATTGGG + Intronic
1188529850 X:31127839-31127861 GGGAAGAAAGAGAAGGAGAGAGG - Intronic
1188606892 X:32042395-32042417 GGCAAGAAGGAGAATGAGTGAGG + Intronic
1188673659 X:32912076-32912098 GAGGAAGAGGAGAAGGAATGGGG + Intronic
1188811172 X:34656363-34656385 GAGAGGAAGGAAAAAGAGTGGGG + Intronic
1188980183 X:36720428-36720450 GAGAAGAAGAAGAAGAAGGGAGG + Intergenic
1189102983 X:38210298-38210320 GAGGACAAGGAGGAATAGTGAGG - Intronic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189250173 X:39594591-39594613 AAGAACAAAGAAAAAGAGTGAGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1190035323 X:47018203-47018225 GGGAAGAAGGAGATGGGGTGAGG - Intronic
1190085216 X:47389556-47389578 GAGACCAAGGAGAGAGACTGGGG - Intronic
1190259842 X:48790908-48790930 GAGAAGGAGGGGAAGGAGAGGGG + Intronic
1190751395 X:53364846-53364868 GAGAACATGGAGTGGGAGCGAGG + Intergenic
1190992390 X:55565982-55566004 GAGAACAAGGAAAAGCAAGGTGG + Intergenic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191650884 X:63536854-63536876 GAGACCAAGGAAAAGCAGGGTGG + Intergenic
1192202062 X:69072735-69072757 GAGGACAGGAAGAAGGGGTGAGG + Intergenic
1192355451 X:70398614-70398636 GAGAACAAGGAAGATTAGTGAGG - Intronic
1192573066 X:72222061-72222083 GTGGAGAAGGAGGAGGAGTGGGG - Intronic
1192737411 X:73862315-73862337 GAGAACAAAGACAAGGGATGAGG - Intergenic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1193093975 X:77527341-77527363 GAGAGCAAGGAGAAGGGCTACGG + Intronic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1194036367 X:88877987-88878009 GTAAACAAGGGGAAGAAGTGAGG - Intergenic
1194193411 X:90864786-90864808 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194268069 X:91779271-91779293 GTGAACCAGGGGAAGGCGTGGGG - Intronic
1194537632 X:95125622-95125644 GAGAAGGAGGAGAAGGAAAGAGG + Intergenic
1194566846 X:95499567-95499589 GAGGAAGAGGAGAAGGAGCGAGG - Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1194771714 X:97915103-97915125 GAGAGCAAGCCGAAGGAGGGTGG + Intergenic
1194992903 X:100564044-100564066 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1195069642 X:101266782-101266804 GAGAATAAGGAGAAAGAATGAGG - Intergenic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195812573 X:108851063-108851085 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1196284602 X:113864303-113864325 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1197033112 X:121842590-121842612 GAGAACAGGGCTGAGGAGTGGGG - Intergenic
1197793855 X:130280775-130280797 GAAAACAAGGAAAAGGACTCAGG - Intergenic
1197906082 X:131427282-131427304 GAGAAGCAGGAGGAGGAGAGAGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198438703 X:136640989-136641011 GGGAGCATGCAGAAGGAGTGAGG - Intergenic
1198758376 X:140004631-140004653 GAGACCACGGAGAGGCAGTGTGG + Intergenic
1198780386 X:140228965-140228987 GAGACCACGGAGAGGCAGTGTGG - Intergenic
1199273344 X:145912113-145912135 GAGAAAAAGGACATGTAGTGAGG + Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1199901535 X:152177361-152177383 GAGGATAAGGATAAGAAGTGAGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200523818 Y:4247135-4247157 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1200540022 Y:4447173-4447195 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1200585272 Y:5000192-5000214 GTGAACCAGGGGAAGGCGTGGGG - Intergenic
1200611293 Y:5329267-5329289 GGAGACACGGAGAAGGAGTGGGG + Intronic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic
1200780863 Y:7214254-7214276 GGGAACAAGGGAAGGGAGTGGGG + Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201453017 Y:14136382-14136404 GAGAAGGAAGAGAAAGAGTGAGG - Intergenic
1201741150 Y:17325709-17325731 GAGAAAGAGGAGAAAGAGAGAGG + Intergenic
1201942440 Y:19474326-19474348 GAGGAGAAGGGAAAGGAGTGTGG + Intergenic
1202169301 Y:22024094-22024116 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202222060 Y:22562271-22562293 GAGAACCAGAGGAAGGAGGGAGG + Intergenic
1202321055 Y:23633396-23633418 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202374423 Y:24220622-24220644 GAGAAGAAAGAGAAAGAGAGAGG + Intergenic
1202496357 Y:25449498-25449520 GAGAAGAAAGAGAAAGAGAGAGG - Intergenic
1202549712 Y:26036660-26036682 GAGAACCAGAGGAAGGAGGGAGG + Intergenic