ID: 1130755713

View in Genome Browser
Species Human (GRCh38)
Location 15:86760838-86760860
Sequence GTGGCTTTTCCTCTCTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130755713_1130755717 -4 Left 1130755713 15:86760838-86760860 CCACCCTAGAGAGGAAAAGCCAC 0: 1
1: 0
2: 3
3: 19
4: 164
Right 1130755717 15:86760857-86760879 CCACAACTTAAGTTTCTGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 107
1130755713_1130755718 16 Left 1130755713 15:86760838-86760860 CCACCCTAGAGAGGAAAAGCCAC 0: 1
1: 0
2: 3
3: 19
4: 164
Right 1130755718 15:86760877-86760899 AGGTCTACAAAAAAGTGAAGTGG 0: 1
1: 0
2: 0
3: 24
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130755713 Original CRISPR GTGGCTTTTCCTCTCTAGGG TGG (reversed) Intronic
900689166 1:3969447-3969469 GAGGGTTTTCCTCTCTAGAAAGG + Intergenic
900892409 1:5458856-5458878 GAGGCATTTCCTCTCCAGGAAGG + Intergenic
901027946 1:6288906-6288928 GTGGCTTGCCCTCGCTTGGGTGG - Intronic
903997790 1:27318640-27318662 GGGGCATTTCCTCTCTTGGTGGG - Intergenic
906586415 1:46983089-46983111 CTGGCCTTTTCTCTATAGGGTGG + Intergenic
909766130 1:79358475-79358497 GTGGACTTTTCTCTCTAAGGTGG - Intergenic
913962567 1:143351778-143351800 GTGGCTTTTCCTCCCGAAGCTGG - Intergenic
914056922 1:144177363-144177385 GTGGCTTTTCCTCCCGAAGCTGG - Intergenic
914122224 1:144789003-144789025 GTGGCTTTTCCTCCCGAAGCTGG + Intergenic
915486702 1:156226384-156226406 TTGGCCTTTTCTCTCTAGTGGGG + Intronic
917798924 1:178552887-178552909 GTTTCTCTTCCTCTCTATGGTGG - Intergenic
919057210 1:192586133-192586155 GTGGCTCTTCCTCCCTATAGTGG + Intergenic
919981645 1:202645721-202645743 GTGCCCTTTCCCCTCTTGGGCGG + Intronic
923836985 1:237622829-237622851 GTGGCTTTTCATCTCTATGGAGG + Intronic
924164783 1:241270214-241270236 GTGGCTTTTCCTCTCCCATGGGG + Intronic
924207214 1:241725614-241725636 GTGCATTTTCCTCTCTAGCCTGG - Intronic
1063732215 10:8710628-8710650 CTGGCTTTTCATCTCTTGGTGGG + Intergenic
1064333505 10:14416506-14416528 GTGACCTTTTCTCTCTAGTGGGG + Intronic
1065928709 10:30459395-30459417 GTGGCTGATCCTCTCTGGGCGGG - Exonic
1068070275 10:52185797-52185819 GTGGCTTATGCTCTCTAAAGTGG + Intronic
1069999744 10:72367444-72367466 GTGCCATTTCCTCTCCAGGATGG - Exonic
1070907268 10:80084172-80084194 TTGGCTCTTTCTCTCTAGAGGGG + Intronic
1072243251 10:93517528-93517550 GTGACTTTTCCTCTCAATGGAGG + Intronic
1072637707 10:97188149-97188171 CTGGCTTTTCCTCTGAAGGGAGG + Intronic
1073960587 10:108922330-108922352 TTAGCTTTTCCTCTCTAGACTGG - Intergenic
1075668199 10:124245438-124245460 GTGTCTTTTCCACTTTAGGGAGG - Intergenic
1078358804 11:10652634-10652656 GTGACTTTCACTCTCTGGGGCGG - Intronic
1078458351 11:11493315-11493337 GCAGCTTTTCCTCTATTGGGTGG + Intronic
1079401413 11:20109416-20109438 GTGACTTTACCTACCTAGGGAGG - Intronic
1080143187 11:28947107-28947129 CAGACTTTTCCTCTCTAGGTTGG + Intergenic
1080197407 11:29628680-29628702 TTTTCTTTCCCTCTCTAGGGAGG + Intergenic
1081182869 11:40005775-40005797 GTGCCTTTACCTCTCCAGGCGGG + Intergenic
1083100280 11:60297625-60297647 GTGGCTTATCATTTCTAGGATGG + Intronic
1087328625 11:96753223-96753245 GTGGCTGTCCCTCTCCATGGGGG + Intergenic
1091728153 12:2859516-2859538 GTGGCATTTCCTCCCCAGGCTGG + Exonic
1096243708 12:49973049-49973071 CTGGCTTTTGCTCTCTGTGGAGG - Intronic
1099987750 12:89687505-89687527 GTGGGTTTTGCTATCTAGGTGGG + Intronic
1103742775 12:123102536-123102558 GTTGCTTTTGCTGTCTTGGGAGG - Intronic
1108583204 13:51845176-51845198 GTGGCTTTTCCTCTAAGGGGCGG + Intergenic
1110203685 13:72884434-72884456 GTTGCTTTTCCTCTCTAGGTTGG - Intronic
1110522373 13:76495656-76495678 ATGGCTTTTCCTCTCTTTGTGGG + Intergenic
1111144185 13:84158440-84158462 ATGGCTTTTCTTTTATAGGGAGG - Intergenic
1112176410 13:97029785-97029807 GTGGCTGTGACTCTCTAGGAGGG - Intergenic
1113232494 13:108229321-108229343 GTGACTTTTCATCTGTATGGAGG + Exonic
1113767689 13:112891167-112891189 GTGGTCTTTCCTCTGTAGGTGGG + Intergenic
1115754127 14:36516942-36516964 ATGGGTTTTCCACGCTAGGGCGG - Exonic
1118331712 14:64820553-64820575 GTGGCTTTTCCTCTCCCTGGGGG + Intronic
1121111933 14:91318490-91318512 GTGGTTTTTCCTCTCTTTGTAGG - Intronic
1122860714 14:104581219-104581241 CTGGCCTTTCCTCTGCAGGGCGG - Intronic
1124497334 15:30194457-30194479 GTGTCCTTTCCCCTCTTGGGTGG + Intergenic
1124746240 15:32344190-32344212 GTGTCCTTTCCCCTCTTGGGTGG - Intergenic
1125376148 15:39031721-39031743 GTGGCTCATCCTCTCTCCGGAGG + Intergenic
1130290373 15:82594138-82594160 CTGACTTTTCCTCTCTAGCTAGG + Intronic
1130755713 15:86760838-86760860 GTGGCTTTTCCTCTCTAGGGTGG - Intronic
1130888448 15:88112941-88112963 GTGGCTATTCCTCCTTAGGCTGG + Intronic
1130984178 15:88833995-88834017 GTGTCTTCTCCACTCTGGGGAGG - Intronic
1133870400 16:9680472-9680494 TTGCCTTTTCCTCTCAAAGGTGG - Intergenic
1136342107 16:29650921-29650943 GTGGTTATTTCTCTCTTGGGTGG - Intergenic
1137473967 16:48790552-48790574 GTGGGTGTTACTCTCTGGGGTGG - Intergenic
1137864207 16:51876492-51876514 CTGGCCTTTGCCCTCTAGGGAGG - Intergenic
1138820540 16:60254064-60254086 GTGGATTTTCCCTTTTAGGGGGG - Intergenic
1140304977 16:73794469-73794491 GTGTCTTTTACCCTCTAGGGTGG - Intergenic
1141539900 16:84712017-84712039 GTGGCTTTTGCTTTTTAAGGTGG + Intronic
1142027544 16:87822688-87822710 GGGGCTCTTCGTCTCCAGGGAGG - Intergenic
1142648341 17:1329679-1329701 GTTGCTTCTCCTCTCTCGGTGGG - Intergenic
1143909335 17:10234839-10234861 GTTGCTTTTGTTCTCCAGGGAGG - Intergenic
1144939866 17:18931500-18931522 GTGGCTTTGCCTCTCTTCCGTGG + Intergenic
1147249695 17:39145512-39145534 GTGGCTTGTCCTGGCTATGGTGG - Intronic
1147409529 17:40239490-40239512 CTGGCTTATACTCTCTAGGCAGG - Intronic
1151214517 17:72568549-72568571 GTGGCTCTTCCTCCTCAGGGAGG - Intergenic
1152365596 17:79854596-79854618 GTGGCTTGTCATCTCTAGGTTGG + Intergenic
1152735570 17:81995396-81995418 GTGGCTCATCCCCTCAAGGGAGG - Intronic
1153202775 18:2662829-2662851 ATGGCTTTATTTCTCTAGGGTGG + Intronic
1153355895 18:4134877-4134899 GCTGCTTTTCCTCTCTAGGAAGG - Intronic
1153445735 18:5170802-5170824 CTGGCTTTTTCTCCCTTGGGAGG + Intronic
1153504862 18:5786778-5786800 CTGTCTTTTCCTCTCTGTGGGGG - Intergenic
1156094864 18:33517141-33517163 GTGGTTTTTCCGCCCTAGGTGGG - Intergenic
1156488163 18:37479690-37479712 GTGGCTCTTCCACAGTAGGGAGG - Intronic
1157173956 18:45433853-45433875 GTGGCTTTTCCTCTCCTGGAAGG + Intronic
1161680471 19:5677472-5677494 GTGGCTTCTCCTCTCTGAGTGGG + Intronic
1163699533 19:18780462-18780484 GTGGGTTTTCGGCTCTGGGGAGG + Exonic
1164748844 19:30636183-30636205 CTGGCTTTTCTTATCTAGGCTGG + Intronic
1164881949 19:31740241-31740263 TTGGCTTCTCCTCTCTACTGTGG - Intergenic
1202696405 1_KI270712v1_random:130036-130058 GTGGCTTTTCCTCCCGAAGCTGG - Intergenic
925118443 2:1399205-1399227 GTGGCTCTGCCTCCCTCGGGGGG - Intronic
925308242 2:2865185-2865207 GTGGCGTCTCCTGTCTGGGGTGG + Intergenic
926794210 2:16605634-16605656 GTTGCTCTTCCTCTCTTGGTTGG + Intronic
927010221 2:18896496-18896518 GTGGCTTTATCTCTCTTGGCAGG - Intergenic
928125612 2:28613579-28613601 ATGTCTTTTCCTCTTTAGGTTGG - Intronic
930061800 2:47295826-47295848 GTTACTTTTCCTCTGTGGGGAGG + Intergenic
932504301 2:72213971-72213993 TTGGTTTTTCCTCTGTAGGCTGG + Intronic
933628054 2:84624825-84624847 AAGGCATTTCCTCTCTATGGGGG - Intronic
934063357 2:88317634-88317656 GTGGCTTTTCCTCTCTTGCTAGG - Intergenic
936734773 2:115427483-115427505 GTGGCTTATGCTCTCTGGAGTGG + Intronic
940170594 2:150825889-150825911 GTTGCTTTTCTTCTCTAGGGAGG + Intergenic
940656539 2:156493868-156493890 GTGTTTTTTTCCCTCTAGGGTGG + Intronic
940911856 2:159216399-159216421 ATGGCTGTTCCTCTGGAGGGAGG - Intronic
941595890 2:167476536-167476558 TTGGTTTTTCCTTTCAAGGGGGG + Intergenic
942156212 2:173131176-173131198 GTGGCTTTTACCCACTAGAGGGG + Intronic
945130235 2:206563267-206563289 TTTCCTTTTCTTCTCTAGGGAGG - Intronic
946507031 2:220312724-220312746 CTGTCTTTTGCTCTCTTGGGTGG + Intergenic
947918067 2:233847507-233847529 GTGCATTTTCCTCTCAAGGATGG + Intronic
948129437 2:235589607-235589629 GTGGCTTGTCCTCTTTGGGAAGG + Intronic
1173260387 20:41429833-41429855 GTGGCGTTCCCTCTTTAGCGGGG - Intronic
1173736166 20:45363192-45363214 GGAGCTTTGCCTCTCTAGGCCGG + Exonic
1174910423 20:54602084-54602106 GTGGCTGTGCCTCTCTCGTGAGG + Intronic
1174931305 20:54818130-54818152 GTGGCTAATCCTCTCTACAGAGG + Intergenic
1175309173 20:57999480-57999502 GTGGCTTTCCCTCCACAGGGAGG - Intergenic
1175738412 20:61403423-61403445 GTTGCTTTGCTTCTCTTGGGTGG + Intronic
1176183617 20:63766014-63766036 TTGCCTTTTGCTCTCCAGGGTGG - Intronic
1176229981 20:64027632-64027654 GTGGCTTTTGCTCTCTCGGCTGG + Exonic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1176512228 21:7757534-7757556 GTTGGTCTTCCTCTCTAGGCTGG + Intronic
1177731297 21:25029923-25029945 CTGGCTTTTCATTTCTAGAGAGG + Intergenic
1178646340 21:34388058-34388080 GTTGGTCTTCCTCTCTAGGCTGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
950548162 3:13651290-13651312 GTTGCCTTTCCTCTCCAGAGAGG - Intergenic
951597728 3:24336165-24336187 ATGGCTGGTCCTCTCTAGGGAGG + Intronic
951629101 3:24699201-24699223 GTGGCTTTGCATCACTATGGTGG + Intergenic
955620175 3:60854950-60854972 GTGCCTCTTCCTATCTAGGGAGG + Intronic
957905891 3:86554254-86554276 GTGTCTTTTCTTCTCTAGAAGGG - Intergenic
959179229 3:102957236-102957258 GTGGCTTTCCCTCCTTAGGTAGG - Intergenic
959911582 3:111769415-111769437 TTGTCTTTTACTCTCTAGGATGG - Intronic
965606197 3:170499755-170499777 GTGCCTTTTCCACTCTATAGAGG - Intronic
966437647 3:179906428-179906450 GCAACTTTTCCTATCTAGGGTGG + Intronic
967904707 3:194490254-194490276 GAGGCTTTGCCTCTCTGGAGTGG - Intronic
971375571 4:26053242-26053264 GTGGAGCTCCCTCTCTAGGGGGG - Intergenic
974026746 4:56739456-56739478 CTGGGTTTTCCTCTGTAGGTGGG - Intergenic
976167092 4:82267607-82267629 GTGGCTTTTCATTCCCAGGGAGG - Intergenic
976583260 4:86765377-86765399 TTGTCTTTTTCTCTTTAGGGAGG + Exonic
978625090 4:110676425-110676447 GTGGCTTGCCCTCTTTAGAGTGG + Intergenic
979758751 4:124374054-124374076 GTGGCTCTGCATCTCTGGGGTGG - Intergenic
981188328 4:141832076-141832098 GTGGCATTTCCTCTCAAGGCAGG - Intergenic
985775482 5:1839325-1839347 GTGGATTTTCCTCTCTGCGCGGG + Intergenic
988106867 5:26761666-26761688 CTGGCTTTGCCTCTCTAGCTTGG + Intergenic
988929765 5:36026378-36026400 GTGACTTTTCCTTTCTAGGTAGG - Intergenic
990938759 5:61178715-61178737 GTGGCTTCTCCACTCTTGTGGGG - Intergenic
991034852 5:62118957-62118979 GTGACTTTAGCTCTCTAGGGTGG - Intergenic
994400315 5:99271682-99271704 AACTCTTTTCCTCTCTAGGGAGG + Intergenic
997427842 5:133816443-133816465 TGGGCTTTTCATCTCTAGGAGGG - Intergenic
998754098 5:145357271-145357293 GAGGGTTGTCCTCTCTAGTGAGG + Intergenic
999586964 5:153100063-153100085 GTGACTTTACCTCTCCAGGCTGG - Intergenic
999928244 5:156403172-156403194 GTGACTTTTCCTCACTGGGGAGG - Intronic
1001820581 5:174707039-174707061 ATGGGTTTTCCTCTCTAGTTTGG - Intergenic
1002020634 5:176361948-176361970 GTGGCGTTTCCTCTCGGGGCTGG - Exonic
1002020929 5:176364167-176364189 GTGGGTTTTCCCCTCTAAGTGGG + Intergenic
1003506075 6:6741317-6741339 GTGGCTTTTGTGCCCTAGGGTGG + Intergenic
1006459303 6:34149112-34149134 GTTGCTTTCCCTCACCAGGGAGG - Intronic
1010825429 6:80467455-80467477 ATGGATTTTGCTCTCTAGAGTGG + Intergenic
1011028905 6:82899622-82899644 GTGCCTTTTCATCTCTAGATGGG + Intronic
1011250181 6:85363123-85363145 GTGGCCTCTCCTCTGTAGAGTGG + Intergenic
1012917712 6:105188604-105188626 CAGACTTTTCCTCTCTAGGTTGG + Intergenic
1015873297 6:137798636-137798658 ATGGCTTTTCCTCTGAAGGGGGG + Intergenic
1017726635 6:157280937-157280959 GTGACTGTTCCTCTCTAAGTGGG + Intergenic
1018905683 6:168074059-168074081 GTGGCTTCTCATCTATAGTGGGG - Intronic
1024556380 7:50606410-50606432 GTGGCTTCTCCTCTCCAGTATGG - Exonic
1036131766 8:6121445-6121467 GTGCCCTTTTCTGTCTAGGGAGG - Intergenic
1036157005 8:6351546-6351568 GAAGCTTTTCCTCTTTAGGAAGG + Intergenic
1037377659 8:18249440-18249462 ATGGCTTTTCTTCTGTATGGTGG - Intergenic
1043926143 8:86039427-86039449 GTGGCTTCTCCACTCTGGAGGGG + Intronic
1049123754 8:140766532-140766554 GTGGCTGTTCCATTCTAGAGAGG - Intronic
1049341287 8:142113915-142113937 GTGGCTTCTCCTCTTTAGCCTGG - Intergenic
1049365044 8:142233024-142233046 GTGGCTTCTCATCTGCAGGGTGG - Intronic
1056304297 9:85273890-85273912 AGGTCTTTTCCTCTATAGGGGGG + Intergenic
1056823544 9:89861020-89861042 GTGGCTTTGCTTCCCTGGGGTGG + Intergenic
1056946258 9:90999883-90999905 GTGGCTGTTGGTCTCTCGGGTGG - Intergenic
1057006855 9:91568404-91568426 GTGGCTTCTCCTCTCTCTGCTGG + Intronic
1057243934 9:93438237-93438259 CTGGCTCTTCCTCTCTATGGGGG + Intergenic
1058141713 9:101363355-101363377 GTGCCCTTTCCTCTGAAGGGAGG - Intronic
1060216461 9:121741389-121741411 GTGGCTTTGCCTCTCCGGGAGGG - Intronic
1060791047 9:126485864-126485886 GTGGCTTCTCTTCTGTAGAGCGG + Intronic
1061039412 9:128131262-128131284 GTGGCTTTGCTTCCCTGGGGTGG - Intergenic
1186073915 X:5855413-5855435 GTGGCTTTTCCTCTCCCTGATGG + Intronic
1186409845 X:9337039-9337061 ATGGCTTTGCCTCTTTATGGAGG - Intergenic
1187814536 X:23216737-23216759 GTGGCTTTTCCTATCTACAATGG - Intergenic
1188542101 X:31262329-31262351 GTTGGTTTTGCTCTCTAGGAAGG - Intronic
1190041866 X:47078405-47078427 GGGGCCTTTCCTTTCCAGGGAGG - Exonic
1190438303 X:50449590-50449612 ATTGCCTTTTCTCTCTAGGGAGG - Intronic
1192100677 X:68261216-68261238 GTGGCTGTTCCTCTCTGGCAAGG + Intronic
1192148189 X:68695528-68695550 GCAGCTTCTCCTCTCTAGGTGGG - Intronic
1194040690 X:88938621-88938643 GTGGCTCTGTCTCTCTGGGGTGG - Intergenic
1194366453 X:93019512-93019534 CTGGCCTTCCCTCTGTAGGGCGG - Intergenic
1195364723 X:104114994-104115016 CTGGCTCTTCCTCTGAAGGGAGG - Exonic
1195392939 X:104381968-104381990 GTTCCTTTTCCTTTCTAAGGTGG + Intergenic
1197483878 X:127023023-127023045 GTGTTTTTTCCACTCTAGTGAGG + Intergenic
1197717904 X:129722843-129722865 GTTGCTTTACCTCTCCAGGTTGG - Intergenic
1200674680 Y:6135773-6135795 CTGGCCTTCCCTCTGTAGGGCGG - Intergenic