ID: 1130755872

View in Genome Browser
Species Human (GRCh38)
Location 15:86762572-86762594
Sequence CTGAGGGAAGAAGCCCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130755871_1130755872 -8 Left 1130755871 15:86762557-86762579 CCTTACTATAAAGCTCTGAGGGA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1130755872 15:86762572-86762594 CTGAGGGAAGAAGCCCTGACTGG 0: 1
1: 0
2: 2
3: 26
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130755872 Original CRISPR CTGAGGGAAGAAGCCCTGAC TGG Intronic
900124810 1:1064663-1064685 CTCAGGGAAGACCCCCTGCCAGG + Intergenic
900416446 1:2537363-2537385 CTGTGGGGAAAAACCCTGACAGG + Intergenic
900530363 1:3150028-3150050 CTCAGGGCAGGAGCCATGACAGG - Intronic
903827850 1:26158323-26158345 CTGATGGAAGAAGCTCTAAGAGG + Intergenic
903951052 1:26996170-26996192 CTGAGGAAAGAGGCCCAGAGAGG - Intronic
904138801 1:28335376-28335398 CTGAAGGAAGAATGCCTGCCTGG - Exonic
904980769 1:34499190-34499212 CAGAGAGAGGGAGCCCTGACTGG - Intergenic
905145772 1:35885740-35885762 CTGAGGGTAGAAGCAGTGTCTGG + Intronic
906637836 1:47421492-47421514 CTGAGAGGAGAAGCCCTGAGAGG + Intergenic
906679750 1:47718095-47718117 CTGAAAGAAGAAGCCGTGGCTGG - Intergenic
907194203 1:52673145-52673167 TTGAGGCAGGAAGCCCTGGCTGG + Intergenic
909563739 1:77032505-77032527 ATGAGGGGAGAGGCACTGACAGG + Intronic
911056801 1:93715712-93715734 GTGAGGGAAGAAGTGCTGTCAGG - Intronic
912188603 1:107311189-107311211 CTGATGGAAAAAGCACTGAATGG - Intronic
913256257 1:116956705-116956727 GTGAGGGAAGAAGCCATGGGAGG + Intronic
915683360 1:157604819-157604841 CTGAGGTTAGAAGCACAGACGGG - Intergenic
918093356 1:181315911-181315933 CTGAGGGGAGAAGGCCTGGGTGG + Intergenic
919441087 1:197634123-197634145 CCCAGGGAAGAAGCCCTATCTGG - Intronic
920115535 1:203618159-203618181 CTGGGGAGAGAAGCCCTGGCTGG - Intergenic
920427343 1:205888741-205888763 CTGGGGGAGGAAGTCCTGAAGGG + Intergenic
920918194 1:210275646-210275668 CTGAGGGCAGGACCCCTGCCTGG - Intergenic
921148367 1:212380097-212380119 CTGAGGGCAGAAGTACTGACTGG + Intronic
922873292 1:228920368-228920390 CTGATGGGAGAAGCCATGGCTGG - Intergenic
1064306512 10:14172059-14172081 CTGAGGGAACAAGACCTGACTGG - Intronic
1068632430 10:59311654-59311676 CTGAGGGAATGAGCCCTGTCTGG - Intronic
1069403912 10:68077655-68077677 CTGAGGCAACAAGCCCTTAAGGG - Intergenic
1072534954 10:96355466-96355488 CTGAGGGAGGAACTCATGACAGG - Intronic
1072931656 10:99669405-99669427 CTGAGAGAAAACCCCCTGACAGG - Intronic
1074406998 10:113188262-113188284 CTGGGGGAAGAAGGCCTAACAGG + Intergenic
1075152738 10:119949085-119949107 TTGAGGGAAGAAGGCAGGACAGG + Intergenic
1076727164 10:132419304-132419326 CTGAGGGAAGAATTCCTGCTGGG + Intergenic
1077424072 11:2466309-2466331 CTGGGGGGAGAAGTCCTGGCTGG + Intronic
1077593990 11:3515858-3515880 AGGAGGGAAGTAGCCCTGACAGG - Intergenic
1078582354 11:12548275-12548297 CTGCGGGAAGAGGCCCAGGCAGG + Intergenic
1078597065 11:12696806-12696828 CTGAGGGGAGCAGCCCTGCATGG - Intronic
1078643678 11:13118830-13118852 CTGAGGGACGAAGCAAGGACAGG + Intergenic
1079136405 11:17778203-17778225 CTGACAGAGGTAGCCCTGACTGG - Intronic
1081799464 11:45847809-45847831 CAGAGGGGAGAAGCCGAGACCGG + Intronic
1083195237 11:61082111-61082133 CTGGGGGAGGAAGCCTTGGCAGG + Intergenic
1083953071 11:65967448-65967470 CTGAGGGAAGGAGGCCTCTCTGG - Intronic
1084537932 11:69768782-69768804 CTGAGGGAGGAAGCCGTGCGAGG - Intergenic
1084658289 11:70532033-70532055 CAGAGGGAAGAAGCCCAGGTTGG - Intronic
1084823014 11:71706894-71706916 AGGAGGGAAGTGGCCCTGACAGG + Intergenic
1085696958 11:78713194-78713216 CTGATGGATGAAACCCTGGCTGG + Intronic
1086859906 11:91913619-91913641 CTGAGTGAGGAAGGCCTGAAAGG + Intergenic
1089700299 11:120240380-120240402 CGGAGGGAATGAGCTCTGACAGG + Intronic
1090309399 11:125721435-125721457 CTGGGAGAAGCAGCCCTGATAGG + Intergenic
1091207380 11:133831103-133831125 CTGACTGAAGAAGCCCCGAGGGG + Intergenic
1091789199 12:3261741-3261763 CTGGGAAAAGAAGCCCTGAGGGG + Intronic
1092420088 12:8323994-8324016 AGGAGGGAAGTGGCCCTGACAGG - Intergenic
1094012948 12:25828302-25828324 AGGAGGGAAAAAGACCTGACAGG - Intergenic
1096559188 12:52423802-52423824 CTGTTGGGAGAAGCCCAGACCGG - Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1096800007 12:54104192-54104214 TAGAGGGAAGAAGCTCTGCCTGG + Intergenic
1097068683 12:56339112-56339134 CTGGGGGCAGCAGCCCTGCCTGG + Exonic
1098334398 12:69387795-69387817 CTCTGGGAAGAAGCACTGATTGG + Intronic
1100236156 12:92663025-92663047 CTGAGGGAAGAAGGCCAACCTGG + Intergenic
1102037966 12:109782954-109782976 GTGAGGGCAGAAGTCCTGACCGG - Intergenic
1103328342 12:120136686-120136708 TTGCGGGAAGGAGTCCTGACTGG - Exonic
1103382894 12:120508638-120508660 CTGAAGGGAGAAGCACTGAATGG + Intronic
1104771993 12:131369353-131369375 CTGAAGGAAGGAGTCCTGAAGGG - Intergenic
1104895536 12:132161935-132161957 CTGAGGGAAGAGGGGCTGAGTGG - Intergenic
1105595796 13:21836765-21836787 CTGAGGGCAGAAGCACTGGCGGG + Intergenic
1106342112 13:28840262-28840284 CTGAGAGAAGACGACCAGACTGG + Intronic
1106549421 13:30758556-30758578 CTGAAGGAAGAAGCTCAGACTGG - Intronic
1108129230 13:47279387-47279409 CAGAGGGAAAAAGCCAGGACAGG - Intergenic
1114590628 14:23861365-23861387 CTGGGGAAAGAGGCTCTGACTGG - Intergenic
1115336313 14:32246933-32246955 CAAAGGGAAGAAGCCCTGCGCGG - Intergenic
1116379968 14:44254312-44254334 TTGAAGAAAGAAGCCCTTACTGG - Intergenic
1117569220 14:57029725-57029747 CTGAGGGAAGAACCACTTAAAGG - Intergenic
1117632144 14:57704886-57704908 CTGCTGCAAGAAGCCCTGATGGG - Intronic
1117803734 14:59469163-59469185 CTGGGGGAAAAAGTCTTGACTGG + Intronic
1118698956 14:68414146-68414168 CTGAGGGAAGGAGTCCTCCCTGG + Intronic
1119155428 14:72405768-72405790 CTGCTGGAAGAATCCCTGGCAGG + Intronic
1119207560 14:72805983-72806005 ATGAAGGAAGAAGCCCTGACTGG - Intronic
1119305726 14:73606739-73606761 CTCAGGGAAGGAGTCCTGATTGG - Intergenic
1119325080 14:73755072-73755094 CTGAAGGAAGAAGCACTGCCTGG + Intronic
1119613870 14:76085562-76085584 GTAAAGGAAGAAGCCCAGACAGG - Intergenic
1119868102 14:77990885-77990907 CAGTGGGAAGAGGCCCAGACAGG + Intergenic
1121281872 14:92704948-92704970 CTGAGGGCAGGACTCCTGACAGG + Intronic
1122290515 14:100678268-100678290 CTGTGGGAAGAGGCCCTGGGTGG - Intergenic
1122378900 14:101287544-101287566 CCAAGGGACGCAGCCCTGACTGG + Intergenic
1122595264 14:102885952-102885974 CTGAGGCAAGCCGCCCTCACTGG + Intronic
1122748094 14:103911683-103911705 CTGTTGGAGGAAGCCATGACAGG + Intergenic
1123705073 15:22945272-22945294 CTCAGGGCAGACGCCCTGCCCGG + Intronic
1124264244 15:28219406-28219428 CTGAGGGAGGAAGCAGCGACTGG + Intronic
1126251870 15:46576776-46576798 TAGAGGAATGAAGCCCTGACAGG - Intergenic
1127562959 15:60158629-60158651 CTGAGGGAAAAAGCCCCCTCAGG + Intergenic
1128451926 15:67810859-67810881 CTGAGAGACGAAACCCTCACTGG + Intergenic
1129251442 15:74311229-74311251 CTGGGGGAAGGAGCCCTGTCTGG - Intronic
1130755872 15:86762572-86762594 CTGAGGGAAGAAGCCCTGACTGG + Intronic
1130911356 15:88273035-88273057 CTGAGGGAACAAGCCCAGCAAGG - Intergenic
1130977108 15:88785128-88785150 CTGGGGGATGAAGCCCAGGCTGG - Intergenic
1131271580 15:90950460-90950482 CTGCGGCAAGTACCCCTGACAGG + Intronic
1132611890 16:821232-821254 CTGAGAGAAGAGGCCCTGGGAGG + Intergenic
1132650788 16:1020671-1020693 CTGAGGGCAGCAGCCCTGGGGGG + Intergenic
1133028268 16:2997959-2997981 CTGTGGGAAGGAGCCCAGCCAGG + Intergenic
1134135340 16:11673420-11673442 CGGAGGGAAGGAGCCCGGCCGGG + Intronic
1134339588 16:13333004-13333026 CTGAGAGAAGAAGTCTTGAAGGG - Intergenic
1135830613 16:25769574-25769596 CAGAGGGATAAAGCCCTGCCTGG - Intronic
1137337079 16:47560214-47560236 ATGAGGGAACAAGCCCAGAGCGG - Intronic
1137556215 16:49472092-49472114 CTAAGGGCAGAAGCCATGGCTGG - Intergenic
1137579253 16:49623270-49623292 CTGAGGGAAGGCGCCTTGGCTGG - Intronic
1138609363 16:58110653-58110675 CTGAGGGAAGAGGGAATGACAGG - Intergenic
1140884261 16:79229108-79229130 TTGAAGGAAGAAGCTCTGAGAGG - Intergenic
1141173984 16:81707473-81707495 CGGATGGAAAAAGCCCTCACAGG + Intronic
1141510025 16:84505858-84505880 CTGAGGGCAGCAGGCCTGGCTGG + Intronic
1143172648 17:4939072-4939094 CTGAAGGCAGAAGGCCTGAGGGG - Exonic
1144249594 17:13402232-13402254 CTGAGGTGAGAAGCCCTAAAAGG - Intergenic
1146032105 17:29374918-29374940 CTGGTGGAAGAGGCCCTGCCAGG + Intergenic
1147589471 17:41672513-41672535 CTGGGGGATGAATCCCAGACTGG - Intergenic
1147628842 17:41917475-41917497 CTGAGAGAAGCAGCCCACACAGG + Intronic
1147700122 17:42388413-42388435 CCGAGGGAACAAGCCCCAACCGG - Exonic
1148635734 17:49148088-49148110 CTGAGGTCAGAAGCCCAGCCTGG + Intronic
1151271831 17:73002848-73002870 TGGAGGGAGGAAGCCCTGACAGG - Intronic
1151552505 17:74830203-74830225 TGGAGGGATGAAGCCGTGACTGG - Intronic
1151673689 17:75587668-75587690 CAGAAGGAAGAAGTCCAGACAGG + Intergenic
1152586370 17:81191283-81191305 CTGAGGGAAGAAATCCGGAAAGG - Exonic
1152681516 17:81670727-81670749 CTGTGGGAATCAGCCCTGAGGGG + Intronic
1153444336 18:5155015-5155037 CTTAGGGAAGAAAGCCTAACGGG + Intronic
1155169095 18:23253977-23253999 CTGAGAGAGGAACCCCGGACCGG - Intronic
1156040931 18:32822060-32822082 CTGAGGGTAGCATCCCTGAGTGG + Intergenic
1156803079 18:41142408-41142430 CTGAGTTAAGAAACACTGACAGG - Intergenic
1157194197 18:45607231-45607253 CTAGGGGAAAAAACCCTGACTGG - Intronic
1157214670 18:45772999-45773021 TTGAGGGAAGAAGATCTGAGAGG - Intergenic
1160386481 18:78500052-78500074 CAGAAGGAAGAAGCGCTGAGGGG - Intergenic
1162000930 19:7744659-7744681 CTGGAGGAAGAAGTCCTGATGGG - Intronic
1163934041 19:20425116-20425138 CTCAGGGAGGAAGCCCTGTCTGG - Intergenic
1165002687 19:32778225-32778247 GTGGGGTAAGAAGCCCTGGCAGG - Intronic
1165308895 19:35018956-35018978 CTCAGGGCAGAAGCCAAGACGGG + Intronic
1165523124 19:36330092-36330114 GGGAGGGAAGTGGCCCTGACAGG - Intergenic
1166223179 19:41378456-41378478 CGGAGGGAAGAGGCGGTGACAGG - Exonic
927717282 2:25360861-25360883 CTGGGAGGAGAAGCCCAGACAGG - Intergenic
928131884 2:28657709-28657731 GTGAGTGAAGAAACCCTGAAGGG + Intergenic
928166533 2:28976595-28976617 CTGTTGGGAGAAGCCCTGAAGGG + Intronic
931459766 2:62440538-62440560 CTTAGGGAAGAAGGCCTAATGGG + Intergenic
933809921 2:86026851-86026873 CTCAGGGAAGAAGTCTTGATGGG + Exonic
934992803 2:98933262-98933284 TTGAGGGGAGTGGCCCTGACTGG - Intronic
935705245 2:105851111-105851133 CTGAGGGCAGCAGCCCAGCCCGG + Intronic
939491088 2:142877469-142877491 CTCTGGAAAGAAGCCCTCACTGG + Intergenic
941883231 2:170502612-170502634 ATGAGGGAAGGAGCCCAGCCTGG - Intronic
944323476 2:198376341-198376363 TTGAGGGAAGTAGTCCTGGCTGG - Intronic
946568852 2:220998830-220998852 CTGAGTCAAGAAGCCTGGACTGG + Intergenic
947369946 2:229435196-229435218 TCGTGGGAAGAAGCCCCGACTGG + Intronic
947857667 2:233335114-233335136 CTCAGGGAATAAGCCCTGGCAGG + Intronic
947964608 2:234268804-234268826 CAGAGTTAAGAAGCACTGACAGG + Intergenic
1169029967 20:2399510-2399532 TTGAGGTAGGAAGCCCTGCCTGG + Intronic
1170414511 20:16125629-16125651 CTGAGTGAACCAGCCCAGACAGG - Intergenic
1171266081 20:23773239-23773261 CAGAGGGAAGAAGCCAGGGCAGG + Intergenic
1171851800 20:30314019-30314041 TAGAGGGAAGAAGCTCTGCCTGG + Intergenic
1172181859 20:33008444-33008466 TGGAGGGAACAAGCCCTGACTGG - Intronic
1172288329 20:33757109-33757131 GTCAGGGAAAAAGCCCTGCCAGG - Intronic
1172588473 20:36101343-36101365 CTGAGACCAGCAGCCCTGACTGG - Intronic
1172692862 20:36802634-36802656 CAGAGGAAAGCAGGCCTGACAGG + Intronic
1172821003 20:37734339-37734361 CTGAGGGCAGCAGCCTTGCCAGG + Intronic
1173924114 20:46768142-46768164 CTGAGGGAGGCAGCCATCACAGG - Intergenic
1174033177 20:47647371-47647393 CAGAGGGAAGAACACATGACTGG - Intronic
1175132524 20:56800417-56800439 CCGAGGGAAGAGGCTCTGAAGGG - Intergenic
1175285489 20:57834217-57834239 CTGGGAGAAGGAGCCCTCACTGG + Intergenic
1175285495 20:57834236-57834258 CTGGGAGAAGGAGCCCTCACGGG + Intergenic
1175285654 20:57834985-57835007 CAGAGGGAAGAAGCCATGTGAGG - Intergenic
1176053362 20:63132325-63132347 CTGAGGGCAGAGGCACTCACTGG + Intergenic
1180078933 21:45477643-45477665 CTGTGGGAAGCAGCCCAGCCTGG + Intronic
1181464410 22:23103040-23103062 CTGCAGGAAGCAGCCCTGCCTGG - Intronic
1182058317 22:27378658-27378680 CAGAGGGAAGGGGCCCTGCCAGG - Intergenic
1183227564 22:36561069-36561091 CGGAGGGAAGGAGCCAGGACCGG - Intergenic
1183500244 22:38174575-38174597 CTGAGGGAAGGACCCCTAAAGGG + Intronic
1183526499 22:38326199-38326221 AGGAGGGAGGAAGCCCTGGCAGG - Intronic
1184273970 22:43399906-43399928 CTGGGGGAGGAAGCCCTGGGAGG - Intergenic
1184379528 22:44136394-44136416 TTGAGGAAAGATGCACTGACAGG - Intronic
1184490710 22:44807201-44807223 CTGAGGGATCATGGCCTGACCGG + Intronic
1184715487 22:46279561-46279583 CTGGGGGAAGAACCCCAGCCAGG - Intronic
1185108687 22:48888676-48888698 GTCAGGGCAGAAGCCCTTACTGG + Intergenic
950613511 3:14140929-14140951 CTGAGCGAAGATTCCCTGAGTGG + Intronic
950670547 3:14522866-14522888 CTGAGGGAACACTCCCTGCCCGG - Intronic
951067194 3:18280353-18280375 CTGAGGTAAGAGGCTCTGAATGG + Intronic
952119173 3:30220809-30220831 CCCAGGGAAGAAACCCTCACAGG - Intergenic
953014086 3:39055803-39055825 CTGAAGGAAGAGGCCATAACAGG - Intronic
953075852 3:39569729-39569751 CTGTGGGCTGAAGCCTTGACTGG + Intergenic
953089371 3:39708271-39708293 TTTGGGGAAGAAGCACTGACAGG - Intergenic
955666703 3:61356618-61356640 CTGAAGGAAGGAGACCTGCCTGG + Intergenic
956059505 3:65335445-65335467 CTGAGGGCAGAAGCTCTACCTGG - Intergenic
956746490 3:72314929-72314951 TTGAGGGCAGAAGCCATGACTGG - Intergenic
957064031 3:75506539-75506561 AGGAGGGAAGTGGCCCTGACAGG - Intergenic
961173898 3:124818402-124818424 CAGAGGGAAGAAGTCCATACTGG - Intronic
961897771 3:130183186-130183208 AGGAGGGAAGTGGCCCTGACAGG - Intergenic
962973892 3:140429505-140429527 CAGAGGGAAGAAGACTGGACTGG + Intronic
964910061 3:161770318-161770340 CTGGGGGAAAAAAGCCTGACTGG + Intergenic
964926688 3:161967341-161967363 CTGAGGAAAGAAGCCTGGGCAGG + Intergenic
967223640 3:187270723-187270745 CTGTGTGAAGAAGCCCTGTGAGG + Intronic
968133084 3:196203587-196203609 CTGCGGGAAGGAGCCCTGCCTGG + Intronic
968620698 4:1602225-1602247 CTGGGGCAAGAAGCCCTGCCGGG + Intergenic
969007938 4:4036750-4036772 AGGAGGGAAGAGGCCCTGACAGG - Intergenic
969745678 4:9069301-9069323 AGGAGGGAAGTGGCCCTGACAGG + Intergenic
970995648 4:22265041-22265063 TTGAGGGTAGAATCCCTGCCAGG + Intergenic
971133458 4:23839490-23839512 CTGTGGGAAGAAGTCCAGACTGG + Intronic
972365548 4:38371225-38371247 CAGAGTGAAGAAGCTCAGACTGG + Intergenic
973538287 4:51906828-51906850 CTGAGGGAAGCAGCCTTGGTAGG + Intronic
977407601 4:96619914-96619936 CTGAAGGAAGAAGATCTCACAGG - Intergenic
977514736 4:98006988-98007010 CTGAGGGAATTGGCTCTGACAGG - Intronic
979618266 4:122769141-122769163 CAGAGGGAAGCAGCCCTGAGAGG - Intergenic
979671234 4:123362372-123362394 CTTAGAAAAGAAGCCCTGAATGG + Intergenic
980191773 4:129533671-129533693 CAGGGGGCAGAAGCCCTCACTGG + Intergenic
981347827 4:143697251-143697273 CTGAGGGAGAAAGCACTGATAGG + Exonic
981507974 4:145523848-145523870 CTGAAGAATGAAGCCCTGAGAGG - Intronic
983437593 4:167734627-167734649 CTGAGGGAGGGAGGCATGACAGG - Intergenic
984444624 4:179819807-179819829 CTGGAGGAAGAAGGCTTGACAGG - Intergenic
985575276 5:670898-670920 ATGAGGGGAGAAGCCCTCTCAGG - Intronic
996038247 5:118782375-118782397 CTGAGAGAATAAGTCCTGCCAGG - Intergenic
996786044 5:127237658-127237680 CAGCAGGAAGAAGCCCAGACGGG + Intergenic
998415924 5:141945950-141945972 AGGAAGGAAGAGGCCCTGACAGG + Intronic
999716411 5:154364446-154364468 CAGAAGGAAGAGGCCCTGAATGG + Intronic
999821509 5:155233545-155233567 CTCTGGGCAGAAGCCCTGGCAGG - Intergenic
1000151704 5:158508477-158508499 CTGAGGGAAGAAGGGCAGAAAGG - Intergenic
1001642333 5:173253257-173253279 CTGAGGGAATATGCCCAGCCTGG + Intergenic
1001917869 5:175576445-175576467 ATGAGGCAAGAAGTCCTGAGAGG - Intergenic
1002402218 5:178997059-178997081 CTGAGGGAAGAGGCCAGGGCGGG + Intergenic
1002557889 5:180058153-180058175 AGGAGGGAAGGAGCCGTGACTGG + Intronic
1002901946 6:1416935-1416957 CAGGGGGCGGAAGCCCTGACAGG - Intergenic
1006283094 6:33071809-33071831 CTCAGGGAAGACAGCCTGACCGG + Intronic
1006523189 6:34583869-34583891 CTAAGGAAAGAAGCCCTGCAGGG - Intergenic
1007404210 6:41624297-41624319 CTGAGGGAGGAAGCCCTTGCAGG - Intergenic
1011450004 6:87482596-87482618 CTGAGGGAAAAAGCCACAACGGG - Intronic
1011668213 6:89656497-89656519 GGCAGGGAAGAAGCCGTGACGGG + Intronic
1013095111 6:106937618-106937640 AAGAGGCAAGAAGCCCTGCCAGG - Intergenic
1013205741 6:107944394-107944416 CTGAGGAAAGAAGTTCAGACTGG + Intronic
1015737812 6:136419828-136419850 CTGAAGTAAAAAGCCCTTACAGG - Intronic
1020328460 7:6994880-6994902 AGGAGGGAAGTGGCCCTGACAGG - Intergenic
1022455353 7:30553818-30553840 CTTTGGGAAGAATCCCTGATTGG - Intergenic
1022973976 7:35540299-35540321 CTGAGGGAAGAATCCAAGACAGG + Intergenic
1028437699 7:90823499-90823521 CAGAGAGAAGAAGCCCTGTTGGG + Intronic
1029545965 7:101210736-101210758 CTGAGGGAAGAAGGACTTCCCGG - Intronic
1029981469 7:104883663-104883685 CTGAGGGACGTAGCACTAACGGG + Intronic
1035482310 7:159197368-159197390 CAGAGGGAGGAACCTCTGACTGG - Intergenic
1035610458 8:959357-959379 CTGAGGGACCCAGCCCTGCCTGG - Intergenic
1036249281 8:7147809-7147831 AGGAGGGAAGTGGCCCTGACAGG - Intergenic
1036368166 8:8139232-8139254 AGGAGGGAAGTGGCCCTGACAGG + Intergenic
1036882719 8:12526415-12526437 AGGAGGGAAGTGGCCCTGACAGG - Intergenic
1037719366 8:21429805-21429827 CTGATGGGAGAAGCTCTGACGGG + Intergenic
1038540016 8:28384540-28384562 ATGAGGGCAGAAGCCCTGGAGGG + Intronic
1038779630 8:30558745-30558767 CTTGGGGAAGAGGCCCTCACAGG + Intronic
1039219655 8:35315476-35315498 TTGAGTGAAGAAGCCCAGGCTGG + Intronic
1039849294 8:41348426-41348448 TAGAGGGAAGAAGCTCTGTCAGG + Intergenic
1040109414 8:43560349-43560371 GGGAGGGAAGCGGCCCTGACGGG - Intergenic
1041134677 8:54744680-54744702 CTGAGGGAAGAAATAATGACTGG - Intergenic
1043157365 8:76800390-76800412 CTGAGGTAATAAATCCTGACTGG - Intronic
1046193592 8:110831623-110831645 CTGAGGAAGGAACCCCTGACAGG - Intergenic
1048903989 8:139069338-139069360 ATAAGGGAAGAAGCCATTACAGG + Intergenic
1051485532 9:17604177-17604199 CTGAAGGAAGAAGCCCACGCAGG - Intronic
1053789583 9:41677272-41677294 TAGAGGGAAGAAGCTCTGCCTGG + Intergenic
1054155560 9:61637480-61637502 TAGAGGGAAGAAGCTCTGCCTGG - Intergenic
1054177921 9:61888963-61888985 TAGAGGGAAGAAGCTCTGCCTGG + Intergenic
1054659608 9:67691861-67691883 TAGAGGGAAGAAGCTCTGCCTGG - Intergenic
1060485175 9:124042018-124042040 CTGAGGGAAGCAGACAGGACAGG - Intergenic
1060538789 9:124415255-124415277 CTGAGGGAAGAATTCATGGCGGG - Intronic
1061697948 9:132392024-132392046 CTGAAGAAATAAGCCCTGACAGG - Intronic
1061845888 9:133387873-133387895 CTGAGGGAAGGAGACCAGACAGG - Intronic
1062732364 9:138117331-138117353 CTGAGGGAGGAAGCCCCTAGAGG + Intronic
1186134590 X:6505758-6505780 CTGAGGGCAGAAACCCAGCCGGG + Intergenic
1186276098 X:7939674-7939696 CTGAGTGAGGAAGGCCTGAAAGG + Intergenic
1189114233 X:38327168-38327190 CTGAGGGCAGAGGACCGGACGGG - Intronic
1189735317 X:44064159-44064181 GTCAGGGAAGAAAGCCTGACTGG + Intergenic
1191613068 X:63137254-63137276 CTTAGGGAATAAGCCCTTTCTGG + Intergenic
1191623229 X:63241672-63241694 CTTAGGGAATAAGCCCTTTCTGG - Intergenic
1195742599 X:108080548-108080570 CCGAGGGAAGAAGAACTGAGAGG - Intergenic
1197221495 X:123918688-123918710 CTAAGTGAAAAAGCCCGGACAGG + Intergenic
1197725226 X:129771774-129771796 CTGCACGAAGTAGCCCTGACGGG + Intergenic
1199255666 X:145715998-145716020 CTGAGGGGAGGAGCCCTCTCAGG + Intergenic
1200837647 Y:7748857-7748879 CTGAGGCAGGAAGCAGTGACAGG - Intergenic
1200884156 Y:8252347-8252369 CAGAGGGAAGAAAGCCTGTCTGG - Intergenic
1202195340 Y:22294879-22294901 CAGAGGGAAGAAAGCCTGTCTGG - Intergenic
1202197019 Y:22307079-22307101 CAGAGGGAAGAAATCCTGTCTGG + Intergenic