ID: 1130757761

View in Genome Browser
Species Human (GRCh38)
Location 15:86783957-86783979
Sequence CTGCTGGTTTAGAGGAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 309}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130757751_1130757761 18 Left 1130757751 15:86783916-86783938 CCACCATGCCTTGCCCCCACTTT 0: 1
1: 2
2: 32
3: 404
4: 2591
Right 1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG 0: 1
1: 0
2: 1
3: 32
4: 309
1130757756_1130757761 3 Left 1130757756 15:86783931-86783953 CCCACTTTTCTTAAAAAAATTTT 0: 1
1: 1
2: 16
3: 277
4: 2200
Right 1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG 0: 1
1: 0
2: 1
3: 32
4: 309
1130757755_1130757761 4 Left 1130757755 15:86783930-86783952 CCCCACTTTTCTTAAAAAAATTT 0: 1
1: 0
2: 13
3: 160
4: 1280
Right 1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG 0: 1
1: 0
2: 1
3: 32
4: 309
1130757752_1130757761 15 Left 1130757752 15:86783919-86783941 CCATGCCTTGCCCCCACTTTTCT 0: 1
1: 1
2: 8
3: 101
4: 989
Right 1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG 0: 1
1: 0
2: 1
3: 32
4: 309
1130757757_1130757761 2 Left 1130757757 15:86783932-86783954 CCACTTTTCTTAAAAAAATTTTA 0: 1
1: 3
2: 35
3: 412
4: 3085
Right 1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG 0: 1
1: 0
2: 1
3: 32
4: 309
1130757754_1130757761 5 Left 1130757754 15:86783929-86783951 CCCCCACTTTTCTTAAAAAAATT 0: 1
1: 0
2: 12
3: 85
4: 938
Right 1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG 0: 1
1: 0
2: 1
3: 32
4: 309
1130757753_1130757761 10 Left 1130757753 15:86783924-86783946 CCTTGCCCCCACTTTTCTTAAAA 0: 1
1: 0
2: 4
3: 39
4: 487
Right 1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG 0: 1
1: 0
2: 1
3: 32
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130757761 Original CRISPR CTGCTGGTTTAGAGGAGGAA TGG Intronic
900850424 1:5138333-5138355 TTGTGGGTTTAGAGAAGGAAGGG - Intergenic
902845341 1:19106001-19106023 CTACTGTTTTAGATGGGGAAAGG + Intronic
903472630 1:23598080-23598102 GTGCTGGGTTAGAGGGGGAAAGG + Intronic
904291076 1:29486127-29486149 CTGTTGGTGGAGATGAGGAAGGG + Intergenic
905253383 1:36664567-36664589 CTGGTGGCTTTGAGGAGGGAGGG + Intergenic
905635744 1:39550825-39550847 TTGCTGGTTTTGAAGTGGAAGGG + Intergenic
907694962 1:56715809-56715831 TTGCTGGTTTTGAAGATGAAGGG - Intergenic
907858507 1:58327415-58327437 CTGCTGGGAAAGAGTAGGAATGG - Intronic
907940258 1:59080707-59080729 CTGCAAATTTAGAGGGGGAAAGG - Intergenic
908530145 1:65026518-65026540 TTCCTGTTCTAGAGGAGGAAGGG - Intergenic
909088289 1:71193707-71193729 ATGTTGGTTTGGAGAAGGAAAGG + Intergenic
909497151 1:76291074-76291096 CGGCTTGTTTTGAGCAGGAAAGG + Intronic
910146259 1:84084178-84084200 CAGATGGATTATAGGAGGAAGGG + Intronic
910529451 1:88218925-88218947 TTGCTGGTTTAAAGGTGGAGGGG + Intergenic
910766784 1:90790077-90790099 CTGCTGGCTTTGAGGATGGAAGG + Intergenic
911563193 1:99431420-99431442 CAGCTGCTTGAAAGGAGGAAAGG + Intergenic
912595947 1:110875754-110875776 CTGCTGGGGCAGAGGAGGGAAGG + Intronic
912956606 1:114158088-114158110 CTGCTGAAATAGGGGAGGAATGG - Intergenic
914950892 1:152112552-152112574 CTGCTGGAGCTGAGGAGGAAGGG - Exonic
915231925 1:154452090-154452112 CTGCTGGATGAGAGGCGGCAGGG - Intronic
915722618 1:157995450-157995472 CTGTTGGTGTCGGGGAGGAAGGG + Intronic
917231493 1:172842594-172842616 CTTCTGGGTTAGAGGAGGGCTGG - Intergenic
917313246 1:173699102-173699124 CTCCTGGTTTAGTGTAGGGAGGG - Intergenic
917761002 1:178157581-178157603 TTGCTGGTTTAGAGTAGGGATGG + Intronic
918593747 1:186269097-186269119 ATGCTGCTTTAGTGGAGGGAAGG - Intergenic
919101799 1:193105327-193105349 CGGCTGGTTTGGAGCAGGAGCGG - Intronic
919814711 1:201430063-201430085 CTCCTGGCTGCGAGGAGGAAGGG - Intergenic
920336635 1:205249445-205249467 CTGCTGGTTCAGAGGTGGGTGGG + Intronic
921732295 1:218591838-218591860 CTGCTGGCTTTGATGAGGGAAGG + Intergenic
921997022 1:221431509-221431531 CTGCTGTTTTAGAGGACCCATGG - Intergenic
923339531 1:232995834-232995856 GTGCTGTTTTATAGGAAGAAAGG + Intronic
1063948391 10:11199763-11199785 CTGCTGCTTTAGAGAAGCAATGG - Intronic
1064562970 10:16610844-16610866 CTGCTGGTTTCGAGTAAGGAAGG + Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1066818383 10:39451534-39451556 CTGGTCCTTTAGAGGAGGAGAGG + Intergenic
1067186170 10:44029845-44029867 GTGCTGTTTCAGAGGAGGGAGGG + Intergenic
1067477080 10:46574275-46574297 GTGCTGGTTGAGAGGAGGCAGGG + Intergenic
1067617661 10:47767506-47767528 GTGCTGGTTGAGAGGAGGCAGGG - Intergenic
1070525075 10:77289214-77289236 CTGCTGGGTTCAAGGTGGAAAGG - Intronic
1070762035 10:79029909-79029931 CTGCTGGCTTTGAGGATGGAGGG + Intergenic
1071440200 10:85683554-85683576 CTGCTGCTTTTAATGAGGAAAGG - Intronic
1071947924 10:90668886-90668908 CTGCTTGTTAATATGAGGAAGGG - Intergenic
1072338635 10:94423817-94423839 CTACTGTTTCAGAGAAGGAATGG + Intronic
1072829997 10:98647462-98647484 CTGCTAGTTTCAAGGAGGAGGGG + Intronic
1073123472 10:101135541-101135563 CTGCTGGCCTAGGGGAGGAGAGG + Intronic
1076825319 10:132964325-132964347 CTGCAGGTGGAGAGGAGGCAAGG + Intergenic
1078927069 11:15884807-15884829 CTGGTGGTTGAGGGGTGGAAAGG - Intergenic
1080066447 11:28020570-28020592 CCACTGGTTTAGAGTATGAAAGG + Intergenic
1081532512 11:43972210-43972232 TTGATGGTTCAGAGAAGGAAGGG + Intergenic
1082100886 11:48172021-48172043 GTGTTGGTTTAGAGGAGGCAGGG + Intergenic
1082696839 11:56377644-56377666 CTGCAGGTTCATAGAAGGAAGGG - Intergenic
1083562419 11:63683230-63683252 CTGGTGGTTTAAAGGAGACAGGG - Intronic
1084479497 11:69410499-69410521 CTGTGGGATCAGAGGAGGAAGGG + Intergenic
1084670388 11:70603365-70603387 CTGCTGCCCCAGAGGAGGAAGGG - Intronic
1085155947 11:74294496-74294518 CTGTTCCTTTGGAGGAGGAAAGG + Intronic
1085457799 11:76675084-76675106 GTGCTGGCATAGAGGAGGAGAGG + Intergenic
1086323624 11:85676174-85676196 TTGCTGCTTCAGTGGAGGAAAGG + Intronic
1088746387 11:112808193-112808215 CTCCTGTTTTAGTGGAAGAAGGG + Intergenic
1088904677 11:114145630-114145652 CTGGGGGTTGAGGGGAGGAATGG + Intronic
1089352784 11:117830890-117830912 CTGCTGGGCTGGAGAAGGAAGGG - Intronic
1089523558 11:119081802-119081824 CTGCTAGTGAAGAGGAGGGATGG - Exonic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1092289404 12:7150301-7150323 CTGTAGGTTCTGAGGAGGAATGG - Intronic
1092769771 12:11885903-11885925 CTGTTTGTTCAAAGGAGGAAGGG - Intronic
1097038250 12:56138256-56138278 CTGCTGAGTTAGAGGAGGTAGGG + Exonic
1097610568 12:61814830-61814852 CTGCTGGCTTTGAAGATGAAGGG + Intronic
1097957463 12:65500952-65500974 CTGGTGGTCAGGAGGAGGAAAGG - Intergenic
1098925553 12:76346196-76346218 CAGCTGGCATAGATGAGGAAAGG + Exonic
1099022750 12:77426410-77426432 GTGCTGGTTTTCAGAAGGAATGG + Intergenic
1100278267 12:93092485-93092507 CTGATGGCTTAGCGGAGGCAAGG - Intergenic
1101884478 12:108649950-108649972 CTGCAGGTTTCCAGGAGAAATGG - Intronic
1103479023 12:121238990-121239012 ATGCTGGTTTTGAAGAGCAAAGG - Exonic
1105003173 12:132704207-132704229 GTGATGGGTTAGAGGAGGGAAGG + Intronic
1105246348 13:18654665-18654687 CTGCTCATTTAGAGGTGCAAAGG + Intergenic
1106679910 13:31999149-31999171 CTGCTGGCTTAAAGGTGGAGGGG - Intergenic
1107573963 13:41697250-41697272 ATGGTGGTTTGGAGGAGGATGGG - Intronic
1107784630 13:43942592-43942614 CTGCTGGATTAGCAGAGCAAAGG + Intergenic
1108778010 13:53790424-53790446 ATGGTGGTTTTCAGGAGGAAGGG - Intergenic
1109078983 13:57874013-57874035 ATCCTGGTTTAGAGAAGCAAGGG - Intergenic
1109388162 13:61660023-61660045 CTGCTGGTTTTTTGTAGGAAGGG + Intergenic
1110461565 13:75751025-75751047 TTGCAGGGTTAGAGGAGGCAGGG + Intronic
1111326060 13:86697343-86697365 GTGCTGGTATAGAGGAGCCAAGG + Intergenic
1112455984 13:99564392-99564414 CTGTTGGTTTTGAAGAGTAAAGG + Intergenic
1113973574 13:114209562-114209584 CTGATGGTCTAGAGGAAGGAAGG + Intergenic
1114473561 14:22979748-22979770 ATGCTGGGTTAGAGGAGGTGAGG - Intronic
1116362212 14:44014361-44014383 TTGCAGGTTTATAGGTGGAAGGG + Intergenic
1117253121 14:53954560-53954582 CTGCTGGTGCAACGGAGGAAGGG - Intronic
1118224861 14:63889373-63889395 GTGGTGGTGTAGGGGAGGAAAGG + Intronic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1119404253 14:74386860-74386882 CTGCTTGTTGAGAGCAGGAGTGG + Intergenic
1119821325 14:77618496-77618518 CTGCAGGCTAAGAGGAGTAAAGG + Intergenic
1120568091 14:86083894-86083916 TTTCTGGTTTAAAGGAGAAAGGG + Intergenic
1121209836 14:92199963-92199985 CTGCTGGGGGAGAGGAAGAAGGG - Intergenic
1121944396 14:98105182-98105204 TTGCTGGGTGAGAGGAGGGAGGG - Intergenic
1128089185 15:64907360-64907382 CAGCTGCTTGAGAGGAGGGAGGG - Intronic
1130544997 15:84850231-84850253 ATGCTGGTTTGGAAGAGCAAGGG - Intronic
1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG + Intronic
1132416723 15:101625615-101625637 GTCCTGGTGTAGAGGAGGAAGGG - Intronic
1133431678 16:5742370-5742392 CTGATGGTTTGGAGAAGGAGAGG - Intergenic
1133620726 16:7523819-7523841 CTGCTGGTGTAGATCAGGAAAGG - Intronic
1135467961 16:22703462-22703484 CTCCTGGTTTAATGGAGCAAGGG + Intergenic
1135651003 16:24206597-24206619 TTGCTTCTTTGGAGGAGGAAAGG - Intronic
1135869060 16:26132118-26132140 CTGGTAGCTTAGTGGAGGAAGGG + Intronic
1136137271 16:28264186-28264208 CTGATGGGTCAGAGGAGGAAGGG + Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137790503 16:51170899-51170921 CTGGTGGTTTTGAGGAGGAGAGG + Intergenic
1143180402 17:4980810-4980832 CTGCTTGTTTTGAGGGGAAATGG - Intronic
1144259608 17:13505442-13505464 GTGCAGGTTTGGAGCAGGAAAGG + Intronic
1145301312 17:21640561-21640583 CTGCTGATTTGGAGGCGCAATGG + Intergenic
1145348989 17:22062741-22062763 CTGCTGATTTGGAGGCGCAATGG - Intergenic
1146694266 17:34896870-34896892 CTGCTGAATTAGAGGAAGAAAGG - Intergenic
1147692448 17:42324865-42324887 TTGCTTGTTTAGATGAGGGATGG + Intronic
1147806973 17:43138764-43138786 CTGCTGCTACAGGGGAGGAAAGG - Intergenic
1148168923 17:45503368-45503390 CTGCTGCTATGGGGGAGGAAAGG - Intergenic
1148279894 17:46339645-46339667 CTGCTGCTATGGGGGAGGAAAGG + Exonic
1148302112 17:46557501-46557523 CTGCTGCTATGGGGGAGGAAAGG + Exonic
1149231102 17:54535748-54535770 CTGCTGGATTTTAAGAGGAAGGG - Intergenic
1150400118 17:64849829-64849851 CTGCTGCTATGGGGGAGGAAAGG - Intergenic
1150722209 17:67622950-67622972 CTACTGGTTTGGTGGAGGGAGGG - Intronic
1152464106 17:80456189-80456211 CTGCTAGTGCAGGGGAGGAAGGG + Intergenic
1152667637 17:81580508-81580530 CTGCTGGGGTAGAGGTGGGAGGG - Intronic
1153023958 18:657384-657406 CTGCTGGCTTAGAGAAGGCGCGG + Intronic
1153168002 18:2283904-2283926 CTGCTGCTTTGGGCGAGGAAGGG - Intergenic
1153959762 18:10130818-10130840 CTGCAGGCCTAGAGTAGGAAGGG - Intergenic
1154442513 18:14404458-14404480 CTGCTCATTTAGAGGTGCAAAGG - Intergenic
1156765407 18:40648143-40648165 TGGCTGTTTTAAAGGAGGAATGG - Intergenic
1157463466 18:47923823-47923845 CTACTGGTTTCGAGCAGAAATGG + Intronic
1157848569 18:51026959-51026981 CTGCCGGTTTAGAGGAGGAGGGG + Intronic
1159094257 18:63884703-63884725 TTGGTGTTATAGAGGAGGAAAGG - Intronic
1159388655 18:67759553-67759575 CTGCTGGGTTGGAGCAGGGAAGG - Intergenic
1160846260 19:1167535-1167557 CTGCTGGCTTTTAGGAGGGAGGG - Intronic
1162528695 19:11222869-11222891 CTGCTGGATTAGGGGACGACTGG + Exonic
1164527575 19:29023093-29023115 CTGGAGGTTTTGAGGAGGGATGG + Intergenic
1165855874 19:38879073-38879095 CTGCTGGTTAAGAGGGGGCCAGG + Exonic
1166948260 19:46410444-46410466 CTGCTGGTTTGGAGGGGACAGGG - Exonic
1167019634 19:46863605-46863627 TTGCTGGCTTAGAGGTGGAAGGG - Intergenic
1167838695 19:52095997-52096019 CTGCTGGGTGAGAGGCGGAGTGG - Intergenic
1168093617 19:54101939-54101961 CTGCTGCTTGAGAGCAGTAACGG - Intronic
926328772 2:11807949-11807971 TCGCTGGATTAGAGCAGGAAGGG - Intronic
927436492 2:23070981-23071003 ATGCTGGTTTTGAGGAAGGAGGG + Intergenic
927482435 2:23464987-23465009 CAGCCTGTTTAGATGAGGAAGGG - Intronic
928071208 2:28219296-28219318 TTGCTGGCTTGAAGGAGGAAGGG - Intronic
928399926 2:30970554-30970576 CTCATGGTTTAGAAAAGGAAAGG + Intronic
928472150 2:31585398-31585420 CTGCTGCTTGAGAAGAGGAGAGG + Intergenic
929827192 2:45318109-45318131 TTGCTGGTTTTGAAGATGAAAGG + Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
933423867 2:82086070-82086092 TTACAGGTTTATAGGAGGAAGGG - Intergenic
933446578 2:82387425-82387447 CTTCTGCTTAAGAGGAGGAGAGG + Intergenic
934649904 2:96084819-96084841 CTGCTGGGCTGGAGGAGGCAAGG + Intergenic
934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG + Intronic
935503242 2:103868146-103868168 CTGCTGGTTTGGAAGATGGATGG + Intergenic
935871207 2:107451964-107451986 CTGCTGGGATAGAGGTGGAGGGG + Intergenic
936049646 2:109213360-109213382 CTGCTGGGTGACAGGAGGGACGG + Intronic
936866820 2:117084452-117084474 CTGCTGATTTAGGGAAAGAAAGG - Intergenic
936932259 2:117802154-117802176 ATGCTGGTAGAAAGGAGGAAGGG - Intergenic
937470609 2:122171025-122171047 CTGCTGGCTTTGAGGATGGAGGG + Intergenic
937666887 2:124498139-124498161 CTTCTGGTTTAGTGGCAGAATGG + Intronic
937986997 2:127642463-127642485 CCTCTGGTTTGGAGGAGGAGGGG - Intronic
939678743 2:145104625-145104647 CTGCTGTTTTAGAGGGGACAAGG + Intergenic
940283961 2:152015105-152015127 GTGCTGGTTGAGGGGAGTAATGG - Intronic
941297785 2:163761654-163761676 CAGCTAGTTTAAAGGAAGAAGGG - Intergenic
941699819 2:168592467-168592489 CTGAGGGTTTTGAGCAGGAAGGG + Intronic
942262580 2:174183975-174183997 CTGCTGGTTGAGAACAGGAGAGG - Intronic
942956905 2:181783955-181783977 CTGCTGTTACAGGGGAGGAAAGG - Intergenic
943437742 2:187887225-187887247 TTATTTGTTTAGAGGAGGAATGG - Intergenic
945513497 2:210732214-210732236 CTGCGGGTTTACTGAAGGAAAGG - Intergenic
945819230 2:214643221-214643243 CTGTTGGTTCAGACAAGGAAAGG + Intergenic
946744851 2:222835501-222835523 CTGCTGCTGTAAAGAAGGAATGG - Intergenic
947855865 2:233324080-233324102 CTGCTGAGTGAGAGGAGCAAGGG + Intronic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
948165269 2:235856511-235856533 CTGCTGGCTTAGATGTGGAAAGG - Intronic
948413033 2:237779269-237779291 CAGTTGTTTCAGAGGAGGAAGGG + Intronic
1168895333 20:1319988-1320010 GTGCTGGGATGGAGGAGGAAGGG + Intronic
1169494948 20:6106403-6106425 ATGCTGGTGTAGATGAGAAAGGG + Intronic
1169844460 20:9974555-9974577 CTGCTGGCTTTGAAGATGAAGGG - Intergenic
1169875922 20:10296993-10297015 CTGCTCGTGTAGTGGACGAACGG + Exonic
1170047322 20:12099249-12099271 GTCCTGGTTTAAAGTAGGAATGG + Intergenic
1170528864 20:17268933-17268955 CTGATGGATTAGATGAGGAATGG + Intronic
1171558953 20:26104267-26104289 CTGCTGATTTGGAGGTGCAATGG - Intergenic
1173006143 20:39141219-39141241 CTGGTGGCATGGAGGAGGAAGGG - Intergenic
1174142897 20:48429024-48429046 CTGCTGGCTTTGAGGATGGAAGG - Intergenic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1175337869 20:58207704-58207726 CTCCTGGCTTTGAGGAGAAATGG - Intergenic
1175401566 20:58702463-58702485 TTTGTGGTTTAGAGGAGGGATGG - Intronic
1176453567 21:6886732-6886754 CTGCTCATTTAGAGGTGCAAAGG + Intergenic
1176831742 21:13751780-13751802 CTGCTCATTTAGAGGTGCAAAGG + Intergenic
1178314234 21:31555940-31555962 TTTCTGGTTTAGAGGGGGAGGGG + Intronic
1178698058 21:34810973-34810995 CTGCTGCTCTGCAGGAGGAAGGG - Intronic
1179149144 21:38795492-38795514 CTGATGGTTTATGGGAGTAAAGG + Intergenic
1179152149 21:38818235-38818257 CTGCTGGTTGAGAAGCTGAATGG + Intronic
1180858884 22:19065512-19065534 CTGCTGTTTTAGTGGAGGGTTGG - Intronic
1181894979 22:26099238-26099260 CTCCTGGTTAAGAGGAGGACTGG + Intergenic
1182592681 22:31394195-31394217 CTGCTGGCTTGGGGGAGGGAGGG - Intergenic
1184065668 22:42118638-42118660 GAGGAGGTTTAGAGGAGGAAAGG - Intergenic
1184095120 22:42312317-42312339 CTGCTGGTCTAGACAAGGCAGGG - Intronic
1184833894 22:47008954-47008976 TTTGTGGGTTAGAGGAGGAAAGG + Intronic
1184931933 22:47687811-47687833 CTGCTGGCTTTGAGGATGAAGGG - Intergenic
950136969 3:10588326-10588348 TTGCTGGTCTAGAGGAGGAGAGG + Intronic
950550514 3:13663374-13663396 CTGCTGGCTTTGAGGATGGAGGG - Intergenic
951253799 3:20425829-20425851 ATGGAGGTTGAGAGGAGGAAGGG - Intergenic
951913612 3:27776674-27776696 GTGATGGTATAGAGGAGGAAGGG + Intergenic
952280664 3:31920140-31920162 CTAGTGGTTTAGGGGAGGAAGGG + Intronic
952322080 3:32287011-32287033 CTTCTGCTTTAAAGGTGGAATGG + Intronic
952389413 3:32866822-32866844 CTGCTGTTGGAGAGGAGTAATGG + Intronic
952411630 3:33054778-33054800 TTTTTGTTTTAGAGGAGGAAGGG - Intronic
952490614 3:33868659-33868681 CTGTTGGTTTGGAGTTGGAAGGG + Exonic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953287877 3:41630427-41630449 TCGCTGGTTTAGAGAAGGAGAGG - Intronic
954974045 3:54676207-54676229 CTGCTGGGAAAGGGGAGGAAAGG - Intronic
955999201 3:64710722-64710744 CTGTTGGCTTAAATGAGGAAAGG + Intergenic
956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG + Intronic
957713458 3:83894344-83894366 CTGGTGGTGTAAAGGAGGTAAGG - Intergenic
959121018 3:102232185-102232207 CTGCTGGTGTTGAAAAGGAAAGG + Intronic
960096098 3:113691281-113691303 CTGGTGGTTGGGAGGAAGAATGG - Intronic
960255899 3:115511340-115511362 TTGCTGGTTTTGAAGAAGAAAGG + Intergenic
961342513 3:126237996-126238018 CTGCAGGTTCATAGGTGGAAGGG - Intergenic
961524121 3:127485811-127485833 CTGCTGGCTTATACGAGGAAAGG - Intergenic
962023263 3:131522194-131522216 CTGGTGGGGTAGAGGAGGAATGG + Intergenic
962392323 3:134983539-134983561 GTGCTGTTTTAGAGCAAGAAGGG + Intronic
962960897 3:140310098-140310120 CTGCAGTCTTAGAGGAGAAAGGG - Intronic
963102671 3:141621853-141621875 CTGCTGGCTCAGCGGAGCAAAGG + Intergenic
963888796 3:150610483-150610505 TTGCTGGTAGAGAGAAGGAAAGG + Intronic
964011340 3:151895575-151895597 ATGCTGATTTAACGGAGGAAGGG - Intergenic
964817321 3:160730864-160730886 CTGCTGGCTTTGAAGAGGGAAGG - Intergenic
964843043 3:161015208-161015230 CAGCTGGTTTAGGGGAAGGAAGG - Intronic
965384688 3:168031870-168031892 CTGTTGGTTTAAAAGAAGAAAGG + Intronic
967035123 3:185643286-185643308 CTGCTTTTTAAGTGGAGGAAAGG - Intergenic
969260372 4:6029577-6029599 ATGCTGATTTAGGGGAAGAAGGG + Intronic
969417713 4:7071852-7071874 TTGCTGGTTTGAAGGAGGAAGGG + Intergenic
970819424 4:20195873-20195895 CTGATGGTGTAGAGGTGGGAAGG - Intergenic
972708112 4:41565687-41565709 CTGATGGTTGAGAGAGGGAAAGG + Intronic
973716947 4:53686189-53686211 CTCCTGTCTTAGAAGAGGAATGG - Intronic
976528185 4:86117782-86117804 TTCCTGGTTAAGAGGAGGAGTGG + Intronic
980716162 4:136632522-136632544 CTACTAGGTTAGGGGAGGAAGGG - Intergenic
980865140 4:138545614-138545636 TTCCTGGTTTAGAGTTGGAAGGG - Intergenic
982582893 4:157201746-157201768 CTGAAGGTTTAGACAAGGAAAGG + Intergenic
983090619 4:163497591-163497613 CTGCTGGATTTGAAGAGGGAAGG - Intronic
983985294 4:174052453-174052475 GTGGGGGTTGAGAGGAGGAAGGG - Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985840150 5:2299967-2299989 CTGCTGGAGTGGAAGAGGAAAGG - Intergenic
986707881 5:10466361-10466383 CTCCAGGGTTAGAGGAGGCAGGG - Intronic
986730127 5:10629163-10629185 CTGCTGGTGTGGAGAATGAATGG + Intronic
987264303 5:16235998-16236020 CTGCATGTCTAGGGGAGGAAAGG - Intergenic
988673832 5:33410584-33410606 CTTGTAGTTCAGAGGAGGAAAGG - Intergenic
988676759 5:33440872-33440894 CCACTGGCTTAGAGGAGGGAGGG + Intronic
988885718 5:35556046-35556068 GTGCTGACTTAGAGGAGGAGGGG - Intergenic
990568900 5:57057685-57057707 TTGCTGGCTTTGAAGAGGAAAGG + Intergenic
992077702 5:73206395-73206417 CTGCTGGCTTTGAAGATGAAGGG - Intergenic
992950464 5:81852461-81852483 CTGCTTGTTTGGAGGATGTACGG + Intergenic
993447002 5:88025556-88025578 CCACTGGTATAGAGGAGGAACGG - Intergenic
995001950 5:107143904-107143926 CCAGTGCTTTAGAGGAGGAATGG - Intergenic
995002080 5:107145434-107145456 CCAGTGCTTTAGAGGAGGAATGG - Intergenic
996538844 5:124607969-124607991 CATCTGGTTTAGTGCAGGAAAGG + Intergenic
997190510 5:131930129-131930151 CTGCTGGTACACAGGAGGAATGG - Intronic
997339007 5:133127967-133127989 GTGCTGGTCTAGAGGCTGAAGGG + Intergenic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
997673243 5:135693768-135693790 CTGAGGGAATAGAGGAGGAAGGG + Intergenic
997740846 5:136252544-136252566 CTGCTGGCTTAGAGGAAGGCTGG - Intronic
998057157 5:139087950-139087972 TGGCTGGTTTGGAGGAGGGAGGG - Intronic
998541214 5:142983067-142983089 CTGGTGGTGTGGAGGAGGACAGG + Intronic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
1001419010 5:171572880-171572902 CTGCAGGTCCAGAGGAGGCATGG - Intergenic
1001542098 5:172546729-172546751 ATGCTGGTCCAGAGGAGGAGGGG + Intergenic
1003646072 6:7913678-7913700 CTGCTGGTTTGGAAGATGAAGGG + Intronic
1003924905 6:10868639-10868661 GTGTTGGTATAGAGGAGGACAGG - Intronic
1004040063 6:11966597-11966619 TTGCTGGTTTAGAGATGGAGGGG + Intergenic
1004072515 6:12313887-12313909 ATGCTTTTTGAGAGGAGGAAGGG - Intergenic
1004592534 6:17067545-17067567 CAGGTGTTTTAGAAGAGGAATGG + Intergenic
1005134852 6:22556318-22556340 CTGCTGGAGTAGAGGAAGGATGG - Intergenic
1005302113 6:24481247-24481269 CTGCTAGTTTAGGCAAGGAAAGG - Intronic
1005495246 6:26382525-26382547 TTGCTGGTGTAGACGAGGAGAGG - Intergenic
1006094360 6:31646635-31646657 CTGCTGGTCCAGAGAAGGATTGG - Intronic
1006413877 6:33892224-33892246 TGGATGGTTTAGGGGAGGAATGG + Intergenic
1006496976 6:34430828-34430850 GAGCTGGGTTAGATGAGGAAAGG + Intergenic
1007280481 6:40708845-40708867 ATGCCAGTTGAGAGGAGGAAGGG - Intergenic
1007324094 6:41047256-41047278 GTGAAGGTTTAGAAGAGGAAAGG - Intronic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1008427987 6:51381269-51381291 GTGATGGATTTGAGGAGGAAAGG - Intergenic
1008797861 6:55326723-55326745 CTGTAGGTTTACATGAGGAAGGG + Intergenic
1011026994 6:82880275-82880297 CTCCTGGTTCAGAGAAGAAAGGG + Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1013624061 6:111919827-111919849 CAGCTGGTTTGGGGGAAGAAAGG - Intergenic
1015138785 6:129906424-129906446 TTGCTGGTTTAAAGGAGCACTGG + Intergenic
1015838399 6:137448022-137448044 CTGAGGGGATAGAGGAGGAAAGG + Intergenic
1015905766 6:138115005-138115027 ATGCTGGTTTAGAAGAAGAAAGG - Intergenic
1016549440 6:145260728-145260750 CTGCTATTTGAGAGGAGGAATGG - Intergenic
1016649770 6:146449897-146449919 CTGCTGGTTGAGCAGAGGGAAGG - Intergenic
1017028718 6:150202509-150202531 CTCCTGGTTGAGAGGAGCCAGGG - Intronic
1017319560 6:153073816-153073838 CTCCTGGGACAGAGGAGGAAAGG + Intronic
1018579392 6:165295699-165295721 TTGCTTGTTTAGAGGGGAAAAGG + Intronic
1018871551 6:167787555-167787577 CTGCTGGGTTTAAGTAGGAATGG + Exonic
1019188542 6:170236117-170236139 CAGGGGGGTTAGAGGAGGAAGGG - Intergenic
1020711808 7:11615480-11615502 CAGCTAGTTTAAAGTAGGAAGGG - Intronic
1023368580 7:39489678-39489700 CTGGTGGTGCAGAGAAGGAAGGG - Intronic
1025278723 7:57609297-57609319 CTGCTGATTTAGAGGTGCAATGG + Intergenic
1026544582 7:71310847-71310869 CTGCTGGTGTAGAAGAGAATGGG + Intronic
1030865935 7:114701722-114701744 CCTCTGGTTTAATGGAGGAAAGG + Intergenic
1031298023 7:120028567-120028589 GTGCTGGTTTTCAAGAGGAATGG + Intergenic
1031817470 7:126455772-126455794 CTGGTGCTATAGAGGTGGAATGG - Intronic
1032778710 7:135144106-135144128 CTTATGGTTGAGTGGAGGAAGGG - Intronic
1034186121 7:149178712-149178734 CTGCTGGTGGAGAAGAGAAAGGG - Exonic
1036491153 8:9226692-9226714 CTTTTTGTTTAGAGTAGGAATGG + Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1038413127 8:27373793-27373815 CTTCTGGTTTAAAGCAGGAGAGG + Intronic
1039858735 8:41438296-41438318 CTGCTGGTTTAGATCCAGAAGGG - Intergenic
1039880677 8:41623658-41623680 CTGATGTTTTAGAGAAGCAATGG - Exonic
1041778531 8:61551906-61551928 CTGGTAGGTTAGAGGGGGAAAGG + Intronic
1042786202 8:72549793-72549815 CTGATTGATTAGAGAAGGAAGGG - Intronic
1042904389 8:73758246-73758268 AAGCTGGAGTAGAGGAGGAAAGG - Intronic
1043158652 8:76818266-76818288 CTTAGGGTTAAGAGGAGGAATGG + Intronic
1043480476 8:80647588-80647610 CTGGTGGTTTAGACTAGGTATGG + Intronic
1043883183 8:85568176-85568198 TTGCTGATCCAGAGGAGGAAGGG + Intergenic
1044607289 8:94058304-94058326 CTGCTGGGACAGAGCAGGAAAGG - Intergenic
1046583794 8:116126091-116126113 TTGTTGGCTTTGAGGAGGAAAGG + Intergenic
1047201875 8:122774047-122774069 CTCCTGGTTTCCAGGAGGAGGGG - Intergenic
1047550858 8:125870963-125870985 ATGCTGATTGAGATGAGGAAGGG + Intergenic
1048009835 8:130446650-130446672 CTCCTGGTAGAGAGGAGAAAGGG - Intergenic
1048184812 8:132229966-132229988 CTGCTGGCTTTCAGAAGGAAGGG + Intronic
1048307610 8:133295195-133295217 CTGCTGGTTCACAGGAGAATGGG + Intronic
1050194412 9:3065898-3065920 CTGTTGGTTTAGTGGAGTGAGGG - Intergenic
1050604785 9:7289554-7289576 CTGCTGCTTTGGAGGAGTGAAGG + Intergenic
1051557574 9:18402212-18402234 CAGCTGGTGTAGAAGAGGAATGG - Intergenic
1051672104 9:19521358-19521380 CTGCAGGATTAGAGGTAGAAAGG + Intronic
1052434648 9:28410439-28410461 CAGCTGGTTTAGGGGAGCAGGGG - Intronic
1055647481 9:78374844-78374866 CTGCTCATATTGAGGAGGAAAGG - Intergenic
1056534207 9:87513833-87513855 CACCTGGTTTAGAGGAAGCAAGG - Intronic
1058503603 9:105647366-105647388 CTGCTGGATTTGAGGAGTAAGGG + Intergenic
1058523081 9:105831419-105831441 CTGCAGGTGTACAGGAGGCATGG + Intergenic
1061856007 9:133442393-133442415 CTGCAGGTTTACAGGCGGTATGG + Exonic
1062222227 9:135422869-135422891 CTGCTCCTTCATAGGAGGAAAGG - Intergenic
1185880556 X:3736235-3736257 GTGCTGGCTTGGAGGAGGAGGGG - Intergenic
1186364190 X:8874314-8874336 CTGCTTGTGAAGAAGAGGAATGG + Intergenic
1188951104 X:36376317-36376339 CTGCTGCTTCAGAGGACTAATGG - Intronic
1189183020 X:39020847-39020869 CTGGGGGGTTGGAGGAGGAAAGG + Intergenic
1189398454 X:40644356-40644378 CTTCTGCTACAGAGGAGGAAGGG - Intronic
1197183075 X:123557537-123557559 CTGCTGGCTTTGAAGATGAAGGG + Intergenic
1199662211 X:150063355-150063377 CTGTTGGTTTTGTGGTGGAATGG + Intergenic
1200003685 X:153074332-153074354 CTGCTGCCTGAGAGGAGGAGAGG - Exonic
1200004038 X:153075677-153075699 CTGCTGCCTGAGAGGAGGAGAGG + Intergenic
1200079550 X:153569190-153569212 CTCCGGGTTTAGAGGAAGCAGGG + Intronic
1200784597 Y:7249117-7249139 GTGCTGGCTTGGAGGAGGAGGGG + Intergenic
1201639854 Y:16167147-16167169 CTGATGGTTTTGAGGAGGTTTGG + Intergenic
1201662959 Y:16418178-16418200 CTGATGGTTTTGAGGAGGTTTGG - Intergenic