ID: 1130760190

View in Genome Browser
Species Human (GRCh38)
Location 15:86811330-86811352
Sequence GAGAACAGTCAGAAGGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130760190 Original CRISPR GAGAACAGTCAGAAGGCTAC TGG Intronic
901935170 1:12621706-12621728 GAGAACAGTGAGGAGGCCATTGG + Intergenic
903145760 1:21370991-21371013 ATGAACAGACAGAAGGATACTGG + Intergenic
903589520 1:24443873-24443895 GAGCAGAGTGATAAGGCTACAGG - Intronic
904681503 1:32232629-32232651 GAGAACAGTGAGGCGGCTGCCGG + Intergenic
905515764 1:38560741-38560763 GAGCAGAGTCACAAGGCTCCTGG + Intergenic
906580422 1:46930920-46930942 GAGTAGAATTAGAAGGCTACAGG - Intronic
906603301 1:47147968-47147990 GAGTAGAGTTAGAAGGCTACAGG + Intronic
906836096 1:49084737-49084759 GAGAAGAGTCTGAATGCTGCAGG - Intronic
908715525 1:67065753-67065775 AAGAACAGTAAGGAGGCTAGAGG - Intergenic
910590089 1:88920892-88920914 GAAGCCAGTCAGAAGGCTCCAGG - Intergenic
911154901 1:94627780-94627802 GAGAGGAGCCAAAAGGCTACTGG + Intergenic
912007466 1:104922161-104922183 AAGAACAGTCAGGATGCAACAGG - Intergenic
913374934 1:118140692-118140714 GAGACCAGTTAGGAGGCCACTGG - Intronic
913669907 1:121087442-121087464 GGGGACAGTTAGAAGGGTACAGG + Intronic
914021670 1:143874840-143874862 GGGGACAGTTAGAAGGGTACAGG + Intergenic
914660156 1:149782791-149782813 GGGGACAGTTAGAAGGGTACAGG + Exonic
915952902 1:160201749-160201771 CAGGACAGTCAGAAAGATACAGG - Exonic
916119975 1:161520680-161520702 GAGGCCAGTCAGGAGGCTATTGG - Intronic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
917213199 1:172651307-172651329 GAGAACATTCTGAAAGCTTCTGG + Intergenic
917458494 1:175206460-175206482 GAGAACATTCAGATTGCCACTGG + Intergenic
918497284 1:185155429-185155451 GACAAAAGTCAGAATGCTTCAGG - Intronic
918953211 1:191168329-191168351 GAGTACAGTGAGAAAGCTATTGG + Intergenic
918995767 1:191757260-191757282 AAGAAAAGTGAGAAGGCTCCAGG + Intergenic
919272646 1:195369596-195369618 GAGAACAGTATGAAGTCAACAGG + Intergenic
919404593 1:197162991-197163013 ACCAAGAGTCAGAAGGCTACAGG + Intronic
920170230 1:204067423-204067445 GAGAACAGGAAGAAGCATACTGG - Intergenic
921365247 1:214367628-214367650 CAGAGCAGGCACAAGGCTACAGG + Intronic
922502525 1:226107943-226107965 GAGACCAGTCAGCAGGCTCTTGG - Intergenic
922537473 1:226391709-226391731 GAGAAGGGTGAGAAGGCTGCGGG + Intronic
924669632 1:246110406-246110428 AAGAACACTCAGGGGGCTACGGG + Intronic
1063423379 10:5932193-5932215 GAGAACAGTCTGAAGTGAACAGG - Intronic
1067065786 10:43103332-43103354 GGAGACAATCAGAAGGCTACAGG + Intronic
1067618867 10:47776090-47776112 GAGCACAGTCAGGAGGAAACCGG + Intergenic
1067705527 10:48604239-48604261 CAGAACACTCAGAAAGCTGCAGG - Intronic
1068491007 10:57723511-57723533 GGGATCAGTCAGAAGGCACCAGG + Intergenic
1069727891 10:70592962-70592984 GAGATCAGTGAGAAGGCCAAAGG + Intergenic
1071089773 10:81904719-81904741 GAGAACAACCAGAATGCTGCAGG - Intronic
1072651568 10:97299852-97299874 GAGAAAAGAAAGAAGGCAACTGG - Intergenic
1073640503 10:105248024-105248046 GATTGCACTCAGAAGGCTACAGG + Intronic
1074151708 10:110765135-110765157 AAGAAAAGTCGCAAGGCTACTGG + Intronic
1078344064 11:10527783-10527805 GAGATCAGTTAGGAGGCTACTGG + Intronic
1080392609 11:31862203-31862225 GAAAGTAGTCAGAAGGGTACTGG + Intronic
1083737574 11:64690458-64690480 GAGAACAGTAAGGACCCTACTGG + Exonic
1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG + Intronic
1085200271 11:74697646-74697668 GAGAACAGACAGAAGAAAACAGG - Intronic
1087542287 11:99534947-99534969 GAGAACTGAAAGAAGGCTAGTGG + Intronic
1088524756 11:110740524-110740546 ATGAATAGTCAGAAGGCTAAAGG - Intergenic
1088527807 11:110775518-110775540 GAGAACAGTCAGAAAAGCACAGG + Intergenic
1090084566 11:123640083-123640105 GAGAGCAGTCCGAAGGCTCCAGG + Intronic
1090423845 11:126593544-126593566 GAGAACAGACAGCAGGCCACAGG - Intronic
1092376119 12:7956678-7956700 GAGACCAGTTAGGAGGCTACTGG + Intergenic
1092696083 12:11172554-11172576 GAGAACAGTATGAAGTCAACAGG + Intergenic
1094660085 12:32461680-32461702 GATAACAGTCACAAGGCAAAGGG - Intronic
1096233514 12:49910576-49910598 AAGAACAGTGAGAAGGGTAGGGG - Intergenic
1096903927 12:54915840-54915862 GAGAACAGTAAGAAGTCAACAGG - Intergenic
1097424308 12:59423461-59423483 GAGAACAGTGAGAAGGATTTTGG - Intergenic
1099615220 12:84925865-84925887 GGGAACATTCAAAAGGATACAGG + Intergenic
1099673649 12:85728681-85728703 GAGAACAGCCGGCAGGCTCCAGG - Intergenic
1104103796 12:125640162-125640184 GTGAGCTGTGAGAAGGCTACTGG - Intronic
1105534732 13:21254839-21254861 GATAACAGTCCCAAGGCCACAGG - Intergenic
1105669967 13:22602537-22602559 GAAAAGAGACAGAAAGCTACAGG + Intergenic
1106242107 13:27920612-27920634 GGGAACAGAGAGAAGGCTCCTGG - Intronic
1107773619 13:43814388-43814410 GTGAACAGACATAAAGCTACTGG - Intergenic
1110347900 13:74469522-74469544 GAGAACAGTGAGAAAGTAACGGG + Intergenic
1110806327 13:79758187-79758209 GACAAAAGTCAGAAGGTAACAGG + Intergenic
1119175397 14:72564709-72564731 GAGACCAGTCAGAAGGAGAAGGG - Intronic
1119663869 14:76470364-76470386 CATAACAGTCAGAAGGTCACAGG + Intronic
1120546707 14:85820575-85820597 GAGAGCAGGGAGAAGGCCACTGG + Intergenic
1120939562 14:89934241-89934263 GAGACCAGTTAGGAGCCTACTGG + Intronic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122755247 14:103973543-103973565 GAGAAGAGGCAGAGGGCTGCCGG + Intronic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123869180 15:24554024-24554046 TAGAACAAACAGGAGGCTACTGG - Intergenic
1125343177 15:38694427-38694449 AAGAACAGTGAGAAGGCTGGTGG + Intergenic
1125430990 15:39593344-39593366 GAGAACCTTCTGAAGGCTGCAGG + Intronic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1128785685 15:70395236-70395258 GGGAACAGACAGAAGGACACAGG + Intergenic
1130760190 15:86811330-86811352 GAGAACAGTCAGAAGGCTACTGG + Intronic
1133514267 16:6492692-6492714 GTGAACAGTCAGAAGGAAACTGG + Intronic
1138294149 16:55872354-55872376 GAGAAATCTCAGAAGGCTTCTGG - Intronic
1139751708 16:69112923-69112945 GAGACCAGTAATAAGGCTGCTGG - Intronic
1140338268 16:74132208-74132230 GAAAACAGCCAGAATGCTTCTGG + Intergenic
1140446029 16:75028761-75028783 GAGAACTGACAATAGGCTACTGG - Intronic
1140488813 16:75317044-75317066 GAGAAAAGGCAAAAGGCTATGGG + Intronic
1144518657 17:15939373-15939395 GTGAAAAGACAGAAGGCTCCAGG - Intergenic
1146630848 17:34468272-34468294 GAGAAAAGAGAGAAGGCGACAGG - Intergenic
1149490445 17:57081069-57081091 GAGAATGATCAGAAGGCTGCTGG + Intergenic
1150143623 17:62750375-62750397 GAGGACAGTCAGGAGGTTCCTGG + Intronic
1150302221 17:64056074-64056096 GAGACCAGTGAGAAGGCACCTGG + Intronic
1151060285 17:71084359-71084381 GGGAGCAGTGGGAAGGCTACTGG + Intergenic
1152058154 17:78049051-78049073 GAGAACAGTAGCATGGCTACAGG + Exonic
1157518598 18:48329026-48329048 GATAACAGTCAGGTGGCCACTGG - Intronic
1158118028 18:54018383-54018405 AAGAACAGGCAGAAAACTACTGG + Intergenic
1158429684 18:57374311-57374333 GAGAAAAGTCAGAATTCAACAGG + Intergenic
1158544922 18:58388045-58388067 GAAAAATGTCAGAAGGCAACAGG + Intronic
1165644099 19:37418810-37418832 GACACCAGGCAGAAGACTACAGG + Intronic
1168377295 19:55891126-55891148 GAGCACAGTGAGAAGGTTTCGGG + Intergenic
925291112 2:2749344-2749366 GACCACAGTCAGGCGGCTACAGG + Intergenic
926723849 2:15982548-15982570 GAGGACAGGCAGAAGGATCCAGG + Intergenic
929264415 2:39902291-39902313 TAGAACAGTCAGATGCTTACTGG + Intergenic
930483406 2:51979333-51979355 GTCAACAGTCAGAATGCTCCTGG + Intergenic
931785390 2:65613436-65613458 GAGAACAGACAGCAGGCTGTAGG + Intergenic
933014837 2:77112144-77112166 GAGGTTAGTCAGAAGGCTCCTGG - Intronic
933976772 2:87518417-87518439 GATAACAGACAGAAGGCTGCTGG - Intergenic
936267974 2:111024767-111024789 GAGAACAGGCAGTTGTCTACCGG - Intronic
936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG + Intergenic
937328792 2:121009049-121009071 GAGACTAGTGAGAAGGCTGCTGG - Intergenic
937590915 2:123612182-123612204 GAGAACAAGAAGAAGGCTAGGGG - Intergenic
939988189 2:148852831-148852853 GTGAACAGTCAGAAGAGTAAAGG - Intergenic
942574499 2:177349160-177349182 AAGACCAGTCAGAAGGCTACTGG + Intronic
943171916 2:184412515-184412537 GAGAACATTCAGAAGACTTTTGG + Intergenic
943561698 2:189471649-189471671 GAAGACAGTCAGAAGGCTCTTGG - Intronic
944896529 2:204171046-204171068 AAGAACAGTCTGAAGGCCAAGGG + Intergenic
945631064 2:212277107-212277129 GAGAATAGTCAGCAAGCTAGGGG + Intronic
945859555 2:215105076-215105098 GAACACAGTCAGAATGCAACAGG - Intronic
946206762 2:218114797-218114819 GAAAACAGTTAGCAGGCTGCAGG - Intergenic
948326528 2:237126304-237126326 GAGCACATTTAGAAAGCTACTGG + Intergenic
1170013767 20:11757399-11757421 CAGAACAGTTGGGAGGCTACAGG - Intergenic
1174979348 20:55375619-55375641 GAGGAAAGTCAGAAGTCTAGTGG - Intergenic
1175592453 20:60203887-60203909 GACAACAGGCAGGAGGCTGCAGG + Intergenic
1178055341 21:28792241-28792263 GAGAACAACCAGAGGGCTGCTGG - Intergenic
1180256713 21:46635038-46635060 GAGTCCAGTCAGACGGCTGCGGG + Intergenic
1181460428 22:23083017-23083039 GAGACCAGGCAGGAGGCTCCAGG + Intronic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1182841378 22:33392924-33392946 CAGAACACTGAGAAGGCTATGGG - Intronic
1183297665 22:37040996-37041018 GGGATGAGTCAGAAGGATACAGG + Intergenic
1184762185 22:46550914-46550936 GAGGACACTCAGAGGGTTACAGG - Intergenic
950009246 3:9711145-9711167 AAGAACAGTGAGGAGGCAACAGG + Intronic
950351695 3:12360608-12360630 TAGAATAGTCAGAGGGCTTCTGG - Intronic
952227369 3:31392145-31392167 GGGCACAGTCAGCAGGCTGCTGG - Intergenic
956582561 3:70830712-70830734 GAGACCAGTTAGAAGGCTGGTGG - Intergenic
960114305 3:113878275-113878297 GAGAATACTCAAAAGGATACTGG - Intronic
962255771 3:133869185-133869207 GAGAAGAAACAGAAGGCAACAGG + Intronic
962578811 3:136778991-136779013 GAGAAAAGGCAGAAAGCCACGGG + Intergenic
962909224 3:139832532-139832554 GAGAGGAGTCAGTAGGCTTCTGG - Intergenic
964585438 3:158293937-158293959 GAGAAAAGTCAAAAAGCTTCCGG - Intronic
965138378 3:164804027-164804049 GATAAAAATCAGGAGGCTACAGG + Intergenic
966175389 3:177132862-177132884 AAGAACAGTAAGAAAGCTATTGG - Intronic
966494864 3:180568453-180568475 AAGAACAGCCAGAAAGCTAGTGG - Intergenic
966823195 3:183941334-183941356 GAGAACAGTAAAAAGGCTTGGGG + Intronic
966904967 3:184515388-184515410 AAGAACAGCAAGAAGGCCACTGG - Intronic
967764349 3:193261955-193261977 GAGGACAGACAGAAGGATAGTGG + Intronic
968044458 3:195616272-195616294 GAGCACAGGCAGGAGGCCACGGG - Intergenic
968060247 3:195722323-195722345 GAGCACAGGCAGGAGGCCACGGG - Intronic
971272621 4:25164809-25164831 GAGAGCTATCAGAAGGCTAAGGG - Intronic
972749614 4:41975211-41975233 GAGAAAAGTGAGGAAGCTACTGG - Intergenic
975627453 4:76363898-76363920 GAGACCAGTGAGAAGGCAACTGG + Intronic
975999843 4:80360661-80360683 TATAACAATCAGAAGGCTAGTGG - Intronic
976844110 4:89467515-89467537 GAGAATACTGAGAAGGCTAATGG - Intergenic
979088347 4:116444368-116444390 GATAACAGTCAGGAGTGTACTGG + Intergenic
979447870 4:120835994-120836016 GAGAACAAACAGAAGGCCAGAGG + Intronic
979810967 4:125035601-125035623 GAGAACAGTCAGGAAGCAGCAGG + Intergenic
981563521 4:146073543-146073565 GAGACCAGCTAGGAGGCTACTGG - Intergenic
982187365 4:152816118-152816140 GAGAACAATTAGGAGCCTACTGG - Intronic
983710623 4:170711569-170711591 GATTACATTGAGAAGGCTACAGG - Intergenic
987783772 5:22471977-22471999 GAGAACAGTAAGAAGGTCACTGG + Intronic
989271536 5:39539284-39539306 CAGACCAGTCTGGAGGCTACTGG + Intergenic
991544630 5:67767780-67767802 GAGATGAGTCATGAGGCTACTGG + Intergenic
993406129 5:87513608-87513630 GATAACACTTAGAAGGCTGCAGG - Intergenic
997487638 5:134245098-134245120 AAGAACACTCAGAGGGCTGCAGG + Intergenic
999323287 5:150627635-150627657 GAGAGCAGTTAGGGGGCTACCGG + Intronic
1000169710 5:158690138-158690160 AAGAACAGAAAGAAGGCTAGAGG - Intergenic
1000466318 5:161581993-161582015 AAGAACAGTCAGAGGGCTTCCGG + Intronic
1005284745 6:24313332-24313354 GAGAATTCTCAGAAGTCTACAGG + Intronic
1006561542 6:34917216-34917238 GAAAACTGTCAGCAGGCTGCTGG - Intronic
1007228337 6:40330269-40330291 GAGGACAGTGAGAAGGCTGCTGG - Intergenic
1012252572 6:96995396-96995418 GAGAAAAGTTAAATGGCTACTGG - Intronic
1013442205 6:110181656-110181678 GAGAAGACTCAGGAGGTTACTGG - Intronic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1017859138 6:158379052-158379074 GAGACCAGTTAGGAGGCTGCTGG + Intronic
1017862247 6:158409618-158409640 GAGAACAGGAAGTAAGCTACTGG + Intronic
1018101156 6:160441643-160441665 GAGAACACACAGAAGTCTACTGG + Intronic
1018236740 6:161733470-161733492 GATAACAGCCAGAATACTACAGG + Intronic
1018640960 6:165903788-165903810 GAGAACAGCCAGGAGGAAACAGG + Intronic
1020980834 7:15066188-15066210 GATAACAGTGAGAAGGGTACTGG + Intergenic
1023207843 7:37770284-37770306 GAGAACAGTCAGAAGGTATGTGG - Intronic
1023387223 7:39671137-39671159 AAGAACAGGTGGAAGGCTACAGG - Intronic
1026434382 7:70382307-70382329 GAGATGAGTTAGAAAGCTACTGG - Intronic
1028809405 7:95067343-95067365 TAAAACAGTCAGAAGACTCCAGG + Intronic
1029278734 7:99423528-99423550 GCGAACTGACAGAAGGCCACTGG + Intronic
1030750273 7:113224398-113224420 GAGAACAATCAAAAGTCTAGAGG + Intergenic
1031027828 7:116699723-116699745 GATATCAGTGAGAAGGCTAAAGG + Exonic
1032263384 7:130353737-130353759 GAGAGCAGTTAGAAAGCAACTGG - Intronic
1032296344 7:130642422-130642444 GATAGAAGTCAGAAGTCTACTGG - Intronic
1033419286 7:141192249-141192271 GAGGACAGGCAGAGGGCTCCAGG + Intronic
1033472342 7:141661376-141661398 GAGAACAGGCAGGTGGCAACAGG + Exonic
1035128447 7:156628588-156628610 CAGAACACTCAGAAGGCAAAGGG - Intergenic
1035444762 7:158932714-158932736 GAGAGCAGTTAGGAGGCTTCTGG + Intronic
1038515886 8:28187411-28187433 GAGAACAGAATGAAGGCTCCAGG - Intronic
1039192339 8:34990909-34990931 GAGAAAAGTAAGAAAGCTGCAGG + Intergenic
1039359555 8:36861082-36861104 AAGAACAGTCAGAAGTCCCCTGG + Intronic
1039569525 8:38575913-38575935 GAGAACCTTCAGAAGGCCAAGGG + Intergenic
1040071664 8:43193588-43193610 GATAACAGGCAGAATGCTTCCGG - Intronic
1041609913 8:59833516-59833538 GAGGGCAGTTGGAAGGCTACTGG + Intergenic
1041672310 8:60504046-60504068 GAGATCACTTAGAAGTCTACTGG + Intergenic
1041972859 8:63762426-63762448 GAGAACACTCATTAGGATACAGG - Intergenic
1042353573 8:67802040-67802062 GAGACCAGTCAGGAGGTTACTGG + Intergenic
1044966103 8:97575466-97575488 GAGAACAGAAAGAAGGCCAGTGG + Intergenic
1045635382 8:104180874-104180896 GAGAAGAATTAGAAAGCTACAGG - Intronic
1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG + Intronic
1050235472 9:3574715-3574737 GGGAAAAGTCAGAAAGATACTGG - Intergenic
1052987605 9:34499537-34499559 GAGAACAGGCAAAAGGATAGAGG + Intronic
1053271118 9:36750168-36750190 GAGAACAGCCACCAGGCTGCAGG + Intergenic
1053429389 9:38032121-38032143 TAGAACAGGCAGGAGGCTAAGGG + Intronic
1053819558 9:41952807-41952829 GAGAAGAGTAAGGAGGTTACCGG + Intronic
1054109825 9:61096460-61096482 GAGAAGAGTAAGGAGGTTACCGG + Intergenic
1054611032 9:67234665-67234687 GAGAAGAGTAAGGAGGTTACCGG - Intergenic
1055820725 9:80259266-80259288 GAGAACCTTCATAAGGCTATTGG + Intergenic
1056335909 9:85568639-85568661 AAGACCAGTCAGAAGGTTACTGG + Intronic
1057803567 9:98204747-98204769 GAGAACAGTCACAGGTCTCCTGG + Intronic
1059780279 9:117518773-117518795 GTGAGCAGTGAAAAGGCTACTGG - Intergenic
1061101189 9:128493744-128493766 GAAAGCAGTCACAATGCTACAGG - Intronic
1061969111 9:134034359-134034381 GGGAACAGTCAGAAAGCTCACGG + Intronic
1203442402 Un_GL000219v1:22191-22213 GAGAACAGCCAGAGCGCTTCTGG + Intergenic
1203513210 Un_KI270741v1:141100-141122 GAGAACAGCCAGAGCGCTTCTGG + Intergenic
1185485341 X:477667-477689 GAGCACAGGCAGACGGGTACAGG + Intergenic
1187672828 X:21685671-21685693 GAGAACAGGCAAAAGGTGACAGG - Intergenic
1187847556 X:23556589-23556611 GAGGACAGACATATGGCTACAGG + Intergenic
1187874891 X:23795982-23796004 GTGAACCGTCAGAAGGCGAAGGG + Intergenic
1189720037 X:43906455-43906477 TAGAAAACACAGAAGGCTACAGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194117841 X:89924487-89924509 AAGACCAGTTAGAAAGCTACAGG - Intergenic
1199383684 X:147199625-147199647 GAGAAGAGTCAGAGGGTAACAGG + Intergenic
1200470620 Y:3581640-3581662 AAGACCAGTTAGAAAGCTACAGG - Intergenic