ID: 1130760720

View in Genome Browser
Species Human (GRCh38)
Location 15:86816714-86816736
Sequence ACTTGGCACAACTGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130760715_1130760720 -2 Left 1130760715 15:86816693-86816715 CCCTCAGGAGGCAGAGAGAAGAC 0: 1
1: 0
2: 0
3: 41
4: 432
Right 1130760720 15:86816714-86816736 ACTTGGCACAACTGGGAAACTGG 0: 1
1: 0
2: 2
3: 11
4: 166
1130760716_1130760720 -3 Left 1130760716 15:86816694-86816716 CCTCAGGAGGCAGAGAGAAGACT 0: 1
1: 0
2: 4
3: 66
4: 432
Right 1130760720 15:86816714-86816736 ACTTGGCACAACTGGGAAACTGG 0: 1
1: 0
2: 2
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130760720 Original CRISPR ACTTGGCACAACTGGGAAAC TGG Intronic
903008760 1:20315806-20315828 ACTTGGCACAACAGAGAAGCTGG + Intronic
903890745 1:26568793-26568815 ACATGACACTACTGGGACACAGG - Intronic
904384466 1:30132355-30132377 ACTTTTCTCATCTGGGAAACAGG + Intergenic
905881637 1:41467834-41467856 ACTTGGGACCTCTGGGAGACAGG + Intergenic
906646747 1:47480662-47480684 AATTGGGAAAACTTGGAAACAGG - Intergenic
907163373 1:52388055-52388077 ACTTGATACACCTGAGAAACCGG - Intronic
907705169 1:56826553-56826575 ACATGGCACAGGTGGGTAACAGG - Intergenic
907837177 1:58121087-58121109 ACTTGACACAAGTAGGAAAATGG + Intronic
908580465 1:65510761-65510783 AGTTGGTACCACTGGGAAAGGGG + Intronic
916711593 1:167415534-167415556 ACTTGATGCAACTGGGAACCTGG + Exonic
918874102 1:190016023-190016045 GGTTGTCACAACTGGGAAAGCGG - Intergenic
923005129 1:230043405-230043427 ACTTTACACAACTTGAAAACTGG - Intergenic
923214849 1:231839198-231839220 ACGTGGCACATCTAGGAGACAGG + Intronic
1069129999 10:64687617-64687639 CCTTGCCACACCAGGGAAACTGG - Intergenic
1071491653 10:86140474-86140496 TCTTGGCACAACAGGGAGCCTGG - Intronic
1073224731 10:101908512-101908534 AGTTGGCACAACTTGGAGAAAGG - Intronic
1074047355 10:109850955-109850977 AATGGGCACAAGGGGGAAACAGG + Intergenic
1076024318 10:127099975-127099997 GCCTGGCCCACCTGGGAAACTGG + Intronic
1076076896 10:127540471-127540493 ACTTGTCACAACTGGGGTACTGG + Intergenic
1076340439 10:129741731-129741753 ACTGGCCACCTCTGGGAAACGGG - Intronic
1076977190 11:182737-182759 ACATGGCAGAATGGGGAAACGGG - Intronic
1079124112 11:17706746-17706768 ACTTTTAAAAACTGGGAAACTGG - Intergenic
1079292578 11:19201627-19201649 AGTTGGAACAACTGGAAAGCGGG - Intronic
1079686289 11:23363293-23363315 AGTTGGAACAGCTGGGACACAGG + Intergenic
1080995393 11:37594263-37594285 ACTTGTCATAACTGGTAAGCTGG + Intergenic
1081385034 11:42461850-42461872 GGTTGGGACAACTGGGAAAGGGG - Intergenic
1081682910 11:45021275-45021297 ACTAGGCACACTTGGGTAACTGG + Intergenic
1081779101 11:45697539-45697561 TCTTGGGAGAACTGGGAAAGAGG + Intergenic
1081895497 11:46582234-46582256 ACTTGACACATTTGAGAAACTGG - Intronic
1084594335 11:70108012-70108034 ACGTGGCACAGCTGTGACACAGG + Intronic
1085242764 11:75072125-75072147 ACTGGGAACACCTGGGAACCAGG + Intergenic
1088751369 11:112844814-112844836 ACTTCTCACCACTGGGGAACAGG - Intergenic
1090521581 11:127485554-127485576 ATTTGGCAGAACTTGGAATCAGG - Intergenic
1091838930 12:3605375-3605397 ACTTGCCACAATAGGGAAGCTGG + Intergenic
1098165617 12:67694630-67694652 AGTTGGCTTAGCTGGGAAACAGG - Intergenic
1098810698 12:75086853-75086875 AGTTGACTCAACTAGGAAACTGG + Intronic
1099397240 12:82156299-82156321 TCTTGGCACACCTAGGAAAAAGG - Intergenic
1100199310 12:92281234-92281256 ATTTGGCAAAACTGGGAATCAGG + Intergenic
1102971743 12:117173544-117173566 ACTTGACACAGCTGGGCCACAGG + Intronic
1103769408 12:123309207-123309229 GCTAAACACAACTGGGAAACAGG + Intronic
1107310158 13:39068714-39068736 ACTTGCCCCAGCTGGTAAACAGG + Intergenic
1109450949 13:62513313-62513335 TCTTTTCACTACTGGGAAACTGG - Intergenic
1110490730 13:76102582-76102604 CCTTGGTAGAACTAGGAAACAGG + Intergenic
1111439338 13:88258907-88258929 TCTTGGGACAAATGGGAAAAGGG - Intergenic
1111985937 13:95067055-95067077 ACATGGGGCAACTGGGAAACAGG + Intronic
1113950811 13:114069972-114069994 ACTTGGGGGAACCGGGAAACTGG + Intronic
1114509678 14:23248074-23248096 ACATGGCAAAAGTGGCAAACAGG + Intronic
1114576936 14:23724019-23724041 ACTTGGAATAACTTCGAAACAGG + Intergenic
1115470287 14:33761567-33761589 ACTTAGCACGACTGTGAAAATGG + Intronic
1118494202 14:66291921-66291943 CCTTGGCACAACATGGGAACTGG - Intergenic
1119501872 14:75135662-75135684 CCTTGGCAAAACTGAGAAAAGGG + Intronic
1121495354 14:94388350-94388372 ACCGGGCAGGACTGGGAAACAGG + Intronic
1122958965 14:105085889-105085911 GCTTGGCAGTAATGGGAAACGGG - Intergenic
1127432411 15:58923421-58923443 ATTTGGCCCAACTGGGAGAAAGG + Intronic
1127759657 15:62126028-62126050 ACTTGGCACAGCTGGAGAGCAGG + Intergenic
1127781486 15:62320353-62320375 AGCTGGCACAACTGTGACACAGG + Intergenic
1127793438 15:62418248-62418270 ACCAGGCACAACTGGGAGAGAGG - Intronic
1127946381 15:63758554-63758576 AAGTGGCAAAAGTGGGAAACGGG + Intronic
1130760720 15:86816714-86816736 ACTTGGCACAACTGGGAAACTGG + Intronic
1134309450 16:13062459-13062481 ACCTGCCACAACTGAGCAACAGG + Intronic
1138144463 16:54596260-54596282 ACTTGGCATAGCTGAAAAACAGG - Intergenic
1140023399 16:71261172-71261194 ACTTGGCCCAACTAGAATACTGG + Intergenic
1141225671 16:82112719-82112741 AATTGGCACAATTTGAAAACTGG - Intergenic
1141518593 16:84562764-84562786 ACCTGGCACAGCTGAGAAATAGG + Intergenic
1142443066 16:90113943-90113965 ACATGGCAGAATGGGGAAACGGG + Intergenic
1142464328 17:120906-120928 ACATGGCAGAATGGGGAAACGGG - Intergenic
1143941165 17:10543119-10543141 CTTTGGCACTACTGGAAAACTGG - Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144337615 17:14285834-14285856 GGTTGTCACAACTGGGAAAAGGG - Intergenic
1149297108 17:55271022-55271044 ACTTGTCACATCTGGGGCACTGG - Intronic
1150149531 17:62797914-62797936 ACTTGGCAGGACTTGGTAACTGG + Intronic
1151642026 17:75403115-75403137 ACTTGGCACAACTAGGAAAAAGG + Intronic
1151919642 17:77144335-77144357 ACTCAGCACACCTGGGATACTGG + Intronic
1152772863 17:82180862-82180884 ACTTTAAACAACTGGGACACTGG + Intronic
1153855359 18:9139085-9139107 ACTACGCAGAACTGGGAAAGTGG + Intronic
1154122400 18:11662580-11662602 TCATGGCACCACTTGGAAACTGG + Intergenic
1155996354 18:32334826-32334848 TCTTGGTAGAAGTGGGAAACAGG + Intronic
1157278420 18:46329168-46329190 TCTTGGCCGAACTGGGAACCTGG - Intronic
1160849720 19:1184533-1184555 ACAGGGCACAAGTGGGAATCTGG + Intronic
1162503233 19:11066659-11066681 ACTTGTGTCATCTGGGAAACAGG - Intergenic
1163807855 19:19410842-19410864 CCTTGACAGAAATGGGAAACAGG - Intronic
1164470617 19:28528016-28528038 ATTTAGCAAAAATGGGAAACTGG + Intergenic
928915811 2:36469167-36469189 TCTTGGCACCACTGGGAAGAGGG - Intronic
933154345 2:78955704-78955726 GCCTGGCACAACTGGAAAAATGG - Intergenic
936907390 2:117552858-117552880 ACATGGCACAAATTGGAAATCGG + Intergenic
940110108 2:150143453-150143475 ACATGGGACAGCTGGGAAACAGG + Intergenic
940408765 2:153335924-153335946 AGCTGGCACAGCTGGGACACAGG - Intergenic
942115629 2:172726481-172726503 ACTTTGCACCAGTGGGAGACAGG - Intergenic
947258338 2:228191293-228191315 ACTTTGCAAAGCTGAGAAACTGG - Intergenic
947739755 2:232479735-232479757 ACTTAGCACAACCGGGACCCTGG - Intergenic
1169489106 20:6056308-6056330 CCTTGCCACCACTGGCAAACTGG - Intergenic
1169947259 20:11002567-11002589 ACTTGGGACAGTTGGGAAAATGG - Intergenic
1173171170 20:40725008-40725030 AGTTTACACAGCTGGGAAACTGG + Intergenic
1174167374 20:48594649-48594671 ACTTGGGACAGGTGGGAACCAGG - Intergenic
1175217075 20:57396959-57396981 ACTGGCCACAACTGGGTGACAGG + Intronic
1181839867 22:25647489-25647511 ACTTGGCACCACTGAGAATGAGG - Intronic
1181939013 22:26461198-26461220 CCTTCCCCCAACTGGGAAACCGG - Intronic
1182377888 22:29861330-29861352 AGTTGTCATAACTGGGAAAAGGG + Intergenic
1183129546 22:35820965-35820987 ACTTGGCAGAACCTGGCAACGGG + Intronic
949775871 3:7631733-7631755 AGTTGACACACCCGGGAAACGGG - Intronic
950258350 3:11524294-11524316 TCTTGTCCCCACTGGGAAACTGG + Intronic
950482961 3:13255932-13255954 TGTTGTCACAACTGGGGAACTGG + Intergenic
953861289 3:46546093-46546115 ACTCAGCCCAACTGGGAACCTGG + Intronic
958710199 3:97708769-97708791 AGCTGGCACAGCTGGGACACTGG - Intronic
961648527 3:128405704-128405726 ACTGGGCAGGACTGGGAAAAGGG + Intronic
962837166 3:139199599-139199621 AATTGTCAAAACTGGGAAACAGG + Intronic
965338911 3:167461926-167461948 TCTTGTCACAACTGGGAAGCTGG + Intronic
967327512 3:188256795-188256817 ACTTGGCCCAAGTGGGTAATGGG + Intronic
968363381 3:198165321-198165343 ACATGGCAGAATGGGGAAACGGG + Intergenic
969986980 4:11222621-11222643 CCTTGGCACAACTGGGCAAATGG - Intergenic
970091174 4:12409844-12409866 ACTTCCTACAACTAGGAAACTGG + Intergenic
970708572 4:18834820-18834842 ACTTGGCACATGTGGCAGACAGG - Intergenic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
972953127 4:44354347-44354369 ACTTTTCACACCAGGGAAACTGG + Intronic
975206403 4:71648602-71648624 ACATGGCATCACTGGGAAGCTGG - Intergenic
977141136 4:93373769-93373791 TCTTGGGAGAACTGGGAAAATGG + Intronic
977555825 4:98486561-98486583 AGGAGGCACAACTGGGAATCAGG + Intronic
977809245 4:101340072-101340094 ACTTTTGACAACTGTGAAACCGG - Intronic
979958927 4:126992092-126992114 AGCTGGCACAGCTGGAAAACAGG - Intergenic
982480769 4:155907195-155907217 ACTTAGCACATATGGGAAAGCGG - Intronic
983661813 4:170136595-170136617 AATTGGCAGAGCTGGGAAATTGG - Intergenic
985410311 4:189676623-189676645 ACGTGGCACGACTGGGGGACCGG - Intergenic
986987866 5:13519656-13519678 AATTGGCACACCTGGGACTCTGG + Intergenic
987233434 5:15918601-15918623 ACTGGGCAACACTGGAAAACTGG + Intronic
987419801 5:17705912-17705934 ACTGGGCACAAATGGTTAACTGG - Intergenic
990026829 5:51202367-51202389 ACTTGTCACAACTGGGAGGAAGG + Intergenic
996024477 5:118629507-118629529 AAATGGCACACCTGGAAAACAGG + Intergenic
997599887 5:135131970-135131992 CCTTGTCACAACTGGGCACCAGG + Intronic
997760847 5:136446135-136446157 GCCTGGCACCACGGGGAAACAGG + Intergenic
1001134989 5:169095114-169095136 ACTTGGCAGAAACGGGAAATAGG - Intronic
1001404657 5:171467373-171467395 AGTTGTCACAACTGGGAGCCGGG + Intergenic
1003964301 6:11238455-11238477 ACTAAGCTCAACTGAGAAACAGG + Intronic
1004029863 6:11856464-11856486 ACTAACCAAAACTGGGAAACAGG + Intergenic
1004381680 6:15138022-15138044 TCTTGCCACCACTGGGAACCTGG - Intergenic
1005805222 6:29468284-29468306 ACCTGGCAGAACAGGGTAACTGG + Intergenic
1007332119 6:41120312-41120334 ACTTGGAATAACTGGGGTACTGG + Intergenic
1010233138 6:73553179-73553201 ACTTGGGACAACTGGTTAAATGG - Intergenic
1013198152 6:107864128-107864150 ACTTGGCACTGCTGGTGAACTGG - Intergenic
1014771770 6:125465556-125465578 AGCTGGCACAGCTGGGACACAGG - Intergenic
1014886745 6:126791215-126791237 ACCTGGCACAACTAGCTAACAGG - Intergenic
1015983560 6:138863391-138863413 AGCTGGCACAACTGTGAAACTGG + Intronic
1016166497 6:140951749-140951771 AAATGACACAAATGGGAAACGGG - Intergenic
1016256537 6:142112178-142112200 ACTTGGCCTGAATGGGAAACTGG + Intergenic
1017450838 6:154553055-154553077 ACATGGCACAATGGGGGAACAGG + Intergenic
1019252319 7:23352-23374 ACATGGCAGAATGGGGAAACGGG - Intergenic
1020879736 7:13744932-13744954 ACTTGGCACAGTAGGGAAAAGGG + Intergenic
1023264998 7:38395058-38395080 ACATGGCACATCTGGGTCACAGG + Intronic
1027623647 7:80522447-80522469 GGTTGGCACAAGTGGGAAAAAGG + Intronic
1031762219 7:125727927-125727949 AGGTGGCAAAACTGAGAAACAGG + Intergenic
1032466356 7:132148075-132148097 ACTTGGCACTAAGGGGAAATTGG + Intronic
1038883452 8:31639418-31639440 AGTTGGCACCACAGGTAAACAGG + Intronic
1038981660 8:32766030-32766052 CCATGGGACAAATGGGAAACAGG + Intergenic
1039609377 8:38907001-38907023 AAATGGCTCAACTGGGTAACAGG - Intronic
1042200916 8:66278819-66278841 TGTTGGCATAACTGAGAAACAGG - Intergenic
1045832006 8:106473239-106473261 TGTTGCCACAACTGGGCAACTGG + Intronic
1046747313 8:117890340-117890362 AGTTGTCACAACTGGGGAATGGG + Intronic
1047076175 8:121406492-121406514 ACTTGGTACAGCCGGGAAACAGG + Intergenic
1047301837 8:123620165-123620187 TCTTTGCAGAAATGGGAAACTGG - Intergenic
1048360426 8:133692863-133692885 AGTTGGCAAGACTGAGAAACTGG + Intergenic
1050988493 9:12114218-12114240 AATTGGAAGAAATGGGAAACAGG - Intergenic
1052180533 9:25520837-25520859 TTTTGCCACAACTAGGAAACTGG - Intergenic
1053046085 9:34918356-34918378 AATTGGGACAACTGGGAGAGGGG - Intergenic
1055794302 9:79958049-79958071 AATGGGCAAAAATGGGAAACAGG - Intergenic
1056099336 9:83285959-83285981 CCTAGGCACCACTGGGCAACGGG - Intronic
1058907915 9:109496767-109496789 GATTGGAACAACTGGGGAACAGG + Intronic
1058930995 9:109718695-109718717 ATTTGTCACAACTGAGAAACTGG + Intronic
1059259557 9:112962626-112962648 AATGGGCATAACTGAGAAACAGG + Intergenic
1060076806 9:120598170-120598192 AATTGGCACAATTGGTAAATTGG - Intergenic
1061368935 9:130187156-130187178 ACAGGGCACACCTGGGAGACGGG + Intronic
1062748023 9:138228563-138228585 ACATGGCAGAATGGGGAAACGGG + Intergenic
1203672447 Un_KI270755v1:28857-28879 ACGTGGCACGACTGGGGGACCGG + Intergenic
1186495478 X:10009661-10009683 GCTTGGCACAACTGGGAGACTGG - Intergenic
1187950878 X:24468925-24468947 AGTGGGCACAAGTGGGAAGCAGG - Intronic
1188451204 X:30309375-30309397 ACTGGGCAGAACTGGGCTACGGG - Exonic
1188461944 X:30437783-30437805 AAATGTCACAACTGTGAAACAGG + Intergenic
1189395151 X:40614763-40614785 ATTTTTCACAACTGGGAAAAGGG + Intergenic
1190955956 X:55193737-55193759 CCTTAGCAAAAATGGGAAACTGG - Intronic
1195023306 X:100850785-100850807 ACTGGACAGAACTGGGAAAGAGG - Intronic
1198523154 X:137473081-137473103 GCCTGGCAGAACTGGGTAACTGG + Intergenic
1199397185 X:147352278-147352300 ACTAGGCAGAACTCTGAAACAGG - Intergenic