ID: 1130762233

View in Genome Browser
Species Human (GRCh38)
Location 15:86832664-86832686
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 4, 1: 43, 2: 79, 3: 92, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130762233_1130762236 -2 Left 1130762233 15:86832664-86832686 CCCATATCACTGTCAGCATTTTG 0: 4
1: 43
2: 79
3: 92
4: 272
Right 1130762236 15:86832685-86832707 TGGTCAAAGCCATTCAACAAAGG 0: 3
1: 1
2: 2
3: 8
4: 163
1130762233_1130762237 4 Left 1130762233 15:86832664-86832686 CCCATATCACTGTCAGCATTTTG 0: 4
1: 43
2: 79
3: 92
4: 272
Right 1130762237 15:86832691-86832713 AAGCCATTCAACAAAGGTCTAGG 0: 1
1: 6
2: 188
3: 1819
4: 2037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130762233 Original CRISPR CAAAATGCTGACAGTGATAT GGG (reversed) Intronic
900395995 1:2453484-2453506 CGGAATGCTGACAGTGATCTGGG + Intronic
901132001 1:6967750-6967772 CTGAAGGCTGAGAGTGATATTGG + Intronic
901343759 1:8519721-8519743 TAAAATCCTGACTGTGATATGGG - Intronic
905607533 1:39316270-39316292 AAAAATGGTGACATTGATTTTGG + Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
906906893 1:49904392-49904414 CAACATGATGACAGAGACATTGG + Intronic
907519909 1:55016385-55016407 CAAAATGATGCCAGTGTTATGGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909097461 1:71305570-71305592 CAAAATGCTGGGATGGATATTGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
910357950 1:86381903-86381925 CAAAATGTTAACAATGATTTTGG + Intronic
910874354 1:91864324-91864346 CAAATTGCTGACAAGAATATTGG + Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912668463 1:111604287-111604309 CTAAATGCTGTCAGTGACACAGG + Intronic
915787576 1:158632656-158632678 CAGAATGCTAGCAGGGATATAGG + Intronic
916494166 1:165329638-165329660 AAAAAACCTTACAGTGATATGGG + Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
916748230 1:167700886-167700908 GAAGATGCTGTCAGTGAGATGGG - Intronic
917692099 1:177480018-177480040 CAAAAATCTGAAAGTGGTATGGG + Intergenic
917728704 1:177852902-177852924 GAGAATGCTGGCAGTGTTATTGG - Intergenic
917771951 1:178289112-178289134 CACAATTCTGGCAGTGATGTGGG - Intronic
918057730 1:181036598-181036620 CAACACACTGAAAGTGATATTGG - Intronic
919135113 1:193497844-193497866 CAAAAATCTCACAGTGAAATAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921616547 1:217274553-217274575 CAGAATGCTGAAACTGAAATAGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922475832 1:225906450-225906472 CCAAAAGCAGACGGTGATATGGG + Intronic
923071994 1:230574121-230574143 CAAAATTCTGACATGAATATGGG + Intergenic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924755044 1:246932695-246932717 CAAAAAGATAACAGTGATTTGGG - Intergenic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068710246 10:60126056-60126078 GAAAATTCTGTAAGTGATATTGG - Intronic
1068749700 10:60577841-60577863 AAAAATGATCACAGTGACATTGG + Intronic
1070465493 10:76718854-76718876 CAAAATGCTGGCAGGAATAGGGG - Intergenic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078343498 11:10520959-10520981 TACAATGCTGACATTGATAATGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079435514 11:20443769-20443791 CAAAAGACTGACAGTCAAATTGG - Intronic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080833488 11:35918272-35918294 CAAAAACCTGACAGTTTTATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083078073 11:60062267-60062289 CAAAATGCTGCCACTGGAATTGG + Intronic
1084913023 11:72406579-72406601 CAAAATGATGGAAGTGAGATAGG - Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087187536 11:95217235-95217257 CAAAAAGCATACATTGATATGGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088069123 11:105759411-105759433 TAAAATGCTGACATTTATGTGGG + Intronic
1089239879 11:117068383-117068405 TGAATTGCTGACAGTAATATGGG - Intronic
1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1091956905 12:4652537-4652559 CCAAATGCTGAAAGTGAAGTAGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095651210 12:44611690-44611712 GAAAATGGTTACAATGATATTGG - Intronic
1095864933 12:46961413-46961435 AAAAATGATGGCAGTTATATGGG + Intergenic
1096662006 12:53131493-53131515 CAAAATGCTGACACAGATGGAGG + Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097820041 12:64119262-64119284 CAAAACTAGGACAGTGATATAGG - Intronic
1098305714 12:69100530-69100552 AAAAATGTAGACACTGATATGGG + Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105982087 13:25527781-25527803 CAAAATGCTGACTGTGCTTAAGG - Intronic
1107648836 13:42523739-42523761 CAAAATGCTACCAGTCATAGGGG + Intergenic
1108027157 13:46190018-46190040 AAAAAAGATGACAGTCATATTGG + Intronic
1108244387 13:48500023-48500045 CTAAATGCTGACAGTGGTTGTGG - Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109978603 13:69874579-69874601 TAAAATGATGACATTAATATAGG - Intronic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111703986 13:91725117-91725139 CAGAATGGTGGAAGTGATATGGG + Intronic
1112453625 13:99536523-99536545 CAAAGTGATGACACTGATTTGGG + Intronic
1112557297 13:100480455-100480477 GCAAAGGCTGACAGTGGTATAGG + Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114058320 14:18995623-18995645 TAAAATGCTGACATTCATGTAGG - Intronic
1114104226 14:19406131-19406153 TAAAATGCTGACATTCATGTAGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115401660 14:32968455-32968477 TAAAATTCTGAAGGTGATATAGG + Intronic
1116119140 14:40699618-40699640 AGAAATACTAACAGTGATATCGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117550456 14:56831101-56831123 CAAAATCCTAACAGTGGTATAGG - Intergenic
1118344255 14:64924626-64924648 CAACAGACTGACAGTGAGATTGG - Intronic
1118438965 14:65795822-65795844 GAAAATGATGTCAGTGATCTGGG + Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1122572106 14:102711846-102711868 CAAAAGGTTGACAGTGATTATGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1123810950 15:23925756-23925778 CAAAATGGTGACTGTGTAATGGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1123984606 15:25634057-25634079 GAGAATGATGACAGTGATAAAGG + Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124713686 15:32036574-32036596 CCAAATGCTGACATGGATAAAGG - Intronic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1125817567 15:42599823-42599845 CAAAAAGCTTACAGTCTTATTGG + Intronic
1125907291 15:43404751-43404773 AAAAAACCTGACAGTGAGATAGG + Exonic
1126360306 15:47838751-47838773 CAGAATGTTGACAGTCATAGAGG + Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127585030 15:60370327-60370349 AAACATGCAGACAGTGGTATGGG - Intronic
1130186589 15:81689318-81689340 CAAAATGCTTCAAGAGATATGGG - Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1131791200 15:95967573-95967595 CTAAATGCTGCCAGTGAACTTGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133495422 16:6312962-6312984 CAAAATGCAAACTGGGATATGGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137805619 16:51302660-51302682 GAAAATGGTGTCAGTGATACAGG + Intergenic
1137928612 16:52565323-52565345 CAACATGCTGACACTGAACTTGG + Intergenic
1137939165 16:52665952-52665974 AAAAATGCTTAATGTGATATTGG - Intergenic
1138637315 16:58351476-58351498 CAACTTGGTGACAGTGATACAGG - Intronic
1138805832 16:60087180-60087202 CAAAAATCTGAAAGTGATTTTGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139830604 16:69794639-69794661 CAAAATTATGACAGAGAAATCGG - Intronic
1142653706 17:1375193-1375215 GATAAAGATGACAGTGATATTGG - Intronic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1143973443 17:10812732-10812754 GAAAATGGTGACAGAAATATCGG - Intergenic
1144319573 17:14101066-14101088 CTAAATGCTGGCAGTGTGATGGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149251427 17:54774561-54774583 CAATTTGCAGACAGTGATATGGG - Intergenic
1149546823 17:57510151-57510173 CAAAAGGCTGAAAGTCCTATGGG - Intronic
1153328618 18:3848751-3848773 TAGGATGGTGACAGTGATATTGG - Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155939800 18:31791885-31791907 CTCAATGCTGCCAGTGACATGGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156274330 18:35568498-35568520 CAAAATGAGGAAATTGATATTGG - Intergenic
1157376026 18:47166170-47166192 CAATATTTTGACAGTGATACAGG - Intronic
1157929269 18:51803234-51803256 GAAAATGCTGACTGTGATTGTGG - Intergenic
1158115239 18:53987828-53987850 CAAGATACTGACATTCATATAGG - Intergenic
1159540724 18:69771902-69771924 CAAAATGATGACAAAGATAAAGG + Intronic
1160192936 18:76730154-76730176 CAACAAGATGACAGAGATATTGG - Intergenic
1164936117 19:32215329-32215351 CAGAATGTTGACATTGCTATAGG - Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1167735412 19:51291619-51291641 CAAAATGATGACAGAAATCTGGG + Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
924984719 2:260084-260106 CAAAATGCAGACAGTAGTATTGG - Intronic
925306986 2:2855061-2855083 CAAAACACTGACAGTAACATGGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925947694 2:8880818-8880840 AAAAAGGCTGACAGTGAAATCGG + Intronic
926776772 2:16430899-16430921 CAAAAAGTTGCCAGTGATGTGGG - Intergenic
927409363 2:22806848-22806870 AAAAATGCTGACAATTACATGGG - Intergenic
928349993 2:30541861-30541883 CCTAATGCTGACAAGGATATGGG - Intronic
928590986 2:32815034-32815056 CACAATGATGACATTGTTATAGG - Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929221741 2:39471777-39471799 GAAAATGTTGGCATTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931419030 2:62108801-62108823 CACAATGCTTACAGTTATCTAGG - Intronic
931621534 2:64215539-64215561 CAAAATGCAGAGACTGCTATTGG + Intergenic
933026219 2:77262851-77262873 CTAAATGATGAGAGTGATAAAGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933360230 2:81272283-81272305 CAAAAGGGTGACAGTAATACAGG + Intergenic
934102945 2:88670426-88670448 CCAAAACCTGACATTGATATTGG + Intergenic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
938476738 2:131622565-131622587 TAAAATGCTGACATTCATGTAGG - Intergenic
939217007 2:139251333-139251355 CAAACTGCTGTCAGTCATCTGGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940734589 2:157435925-157435947 CAAAATTCCTACAGTGATGTAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942905638 2:181177271-181177293 TAAAATGTTCACAGTGAAATTGG - Intergenic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943332253 2:186573461-186573483 CAAAAAGAAGACAGTGATTTAGG + Intergenic
943531590 2:189088473-189088495 CAAAGTGCTGACATTAATAAAGG - Intronic
944452948 2:199861599-199861621 CATGATGATGACAGTGATGTAGG - Intergenic
945511642 2:210710226-210710248 CAAAATGCTGACTTTTATTTGGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946713357 2:222528486-222528508 AAAAATGCTAACAATGATCTGGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947465087 2:230336749-230336771 GGAAAGTCTGACAGTGATATAGG - Intronic
1170199241 20:13724762-13724784 TAACATGCTGAAAGTCATATGGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170903972 20:20494743-20494765 CAAAATGCTAGATGTGATATGGG + Intronic
1171940349 20:31322890-31322912 CAAAATGCTGACACAGAGAGAGG + Intergenic
1172870638 20:38133424-38133446 CAAAAGCCGCACAGTGATATGGG + Intronic
1173211094 20:41032359-41032381 TAAAATGTTGACAGTGAGTTAGG + Intronic
1173240808 20:41295384-41295406 AAAAATGCTTACAATGACATGGG + Intronic
1173246026 20:41338187-41338209 CAAACAGCTGCCAGTGATATAGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177244837 21:18509920-18509942 CAATATGTTGACAGTGAAATGGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1178948851 21:36969414-36969436 CAAAATGCAGACGCTGATTTGGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180476808 22:15718242-15718264 TAAAATGCTGACATTCATGTAGG - Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1180883645 22:19224458-19224480 CACAGAGCTGACAGTGACATGGG + Intronic
1183566468 22:38619051-38619073 GGAAATGCTGACAGTGACAATGG + Intronic
949220861 3:1632458-1632480 TAAAAAACTGAGAGTGATATAGG + Intergenic
949261895 3:2112237-2112259 AGAAATGCTGACAGTGACAGAGG + Intronic
949733457 3:7142711-7142733 CAAAATGTTGACAGGGATCAAGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951336787 3:21433176-21433198 TTAAATGCTATCAGTGATATAGG - Intronic
952252812 3:31671240-31671262 CAAAATTGTAACAGTGATAAAGG + Intronic
952519607 3:34143464-34143486 TAAAATGCTGACATTTGTATTGG + Intergenic
953485448 3:43290134-43290156 CAAAGAGCTGACAGTATTATGGG - Intronic
954975326 3:54688579-54688601 CATTATGATGACAGTGAAATGGG + Intronic
956340416 3:68216840-68216862 CAAAATGAATAAAGTGATATGGG + Intronic
956449233 3:69356839-69356861 CATAATTCAGACAGTGACATTGG - Intronic
957009477 3:74987018-74987040 CAAAATGAAGACATTAATATTGG - Intergenic
957945559 3:87058298-87058320 CAAAAGCCTGACTGTGATATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958592607 3:96177220-96177242 CAAAATGTTGACAGTGCCAGTGG + Intergenic
958813877 3:98894443-98894465 CAAATTGCTGGCACTGATTTAGG + Intronic
959028258 3:101267384-101267406 AAAAAGTCAGACAGTGATATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963181472 3:142361581-142361603 CCAAGTGTTGACAATGATATAGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964219445 3:154326967-154326989 GAAAATGGTGAGAGTGTTATGGG + Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964747826 3:160028284-160028306 CAAAATGATGACAGTTAGAAGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965742747 3:171893403-171893425 CACCATGCTGTCATTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966429252 3:179814174-179814196 CAAAAGGCTTACAGTGAAATGGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967044549 3:185724720-185724742 CAAAGTCCAGACTGTGATATGGG - Intronic
968195054 3:196699577-196699599 CAAAATGCTTACTATGGTATTGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
969552364 4:7879251-7879273 TAAAATGCAGACAGTTATTTTGG - Intronic
969876666 4:10140507-10140529 CAGAATTCTGAAAGTGGTATAGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971005404 4:22369455-22369477 CAAAATGTTGACTGTGTTAGTGG + Intronic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973676267 4:53266764-53266786 TAAAACACTGACAGTGATATTGG + Intronic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
975645199 4:76538916-76538938 CAATATGATGACAGTGATCAAGG - Intronic
975675922 4:76827528-76827550 CACAAAGCTGACTGTGATAAGGG + Intergenic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
976979020 4:91202035-91202057 AAAAGTGCTAAAAGTGATATTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979451678 4:120878886-120878908 CCAAATGCTGACAAGGACATGGG + Intronic
979857168 4:125648910-125648932 CCAAATGTTGGCAGTGATTTTGG - Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982762231 4:159299075-159299097 CAAAACCCTGACAATGATATGGG + Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983607115 4:169600083-169600105 GAAAATGTTAAAAGTGATATTGG - Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
984870403 4:184319883-184319905 CAAAATGTTGCCAATGTTATGGG + Intergenic
985047339 4:185953381-185953403 CAAAATGATGCCAGTGAGAGAGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986447485 5:7835169-7835191 AAAAATGCTGACACAGAGATAGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991096124 5:62741314-62741336 CAAAATTTTGTCAGTGAAATCGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993574217 5:89581251-89581273 CAAAATGCTTACATTAATTTAGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994100261 5:95883738-95883760 CAGAAAGCTGACAGTGGTAGTGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995072348 5:107939291-107939313 CAAAATCATGACTGTGATAACGG - Intronic
995135451 5:108675234-108675256 AAGAATGCTGACAGTGAAAGAGG + Intergenic
995180614 5:109227185-109227207 GAAAATACTGACAGTGAAAGGGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996187358 5:120493592-120493614 CAGAATATTGACATTGATATAGG + Intronic
996809336 5:127497419-127497441 CCAAATGCTGACAAGGATGTGGG + Intergenic
997460724 5:134050513-134050535 CAAAATACTGAGTGTGAAATAGG + Intergenic
998997913 5:147886261-147886283 CAGTATGCTGACATTGATACAGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1002060522 5:176623124-176623146 CAAAATGCTGGGAGTGGTAACGG - Intronic
1003331442 6:5132539-5132561 CAAAAGGCTGAGAGTGAAAGTGG + Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1004624501 6:17362160-17362182 GAAGATGCTGACAGTTGTATCGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1009539259 6:64930711-64930733 AAAAATGCTTACAGTCATCTGGG + Intronic
1009620429 6:66068271-66068293 CTAAATGCTAGCAGTGATTTTGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010082537 6:71880986-71881008 CTAGATGCTGACAATGAAATTGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011907730 6:92392732-92392754 AAAAATGGTGACAGTGAAACAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012366301 6:98444970-98444992 GAAAATGAAGACAGTGATTTTGG - Intergenic
1012379296 6:98600904-98600926 TATAATGATGACAGTGATAAGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015689894 6:135910323-135910345 TAAAGTGCTGACTGTGATACTGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019804184 7:3110795-3110817 CCAAATGCTGACAAAGATGTGGG + Intergenic
1020579420 7:9976190-9976212 CAATATGCTAACATTAATATTGG - Intergenic
1020762714 7:12288536-12288558 GAAAATTATGACAGTGAAATAGG + Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021020370 7:15590863-15590885 CAAAATTCTGACAATGTTTTTGG + Intergenic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022560009 7:31337762-31337784 CACTAAGCTGACAATGATATTGG - Exonic
1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024832228 7:53474049-53474071 CTAAGTGGTGGCAGTGATATTGG + Intergenic
1025961661 7:66227653-66227675 CAAGATGCTGGCAGTGGTAGTGG + Intronic
1026490410 7:70858241-70858263 CAATATGCTGAAAGCAATATGGG - Intergenic
1026796620 7:73369872-73369894 GAAAATGCTAACAGTGAGAAGGG - Intergenic
1028123205 7:87080905-87080927 CTGAATGGTGACAGTGACATAGG - Intergenic
1028201553 7:87967865-87967887 CAAGGTGCTTACAGAGATATTGG + Intronic
1030581895 7:111367100-111367122 GAATATGCTGACAGTGTTCTCGG + Intronic
1031202517 7:118706260-118706282 TAAAATGCTGTCAGTGTTATTGG + Intergenic
1031217340 7:118911989-118912011 ACAAATGCTGACAAAGATATGGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031801420 7:126251370-126251392 CAAGATAGTGACTGTGATATTGG - Intergenic
1032660239 7:133975255-133975277 ATAAATGATGACACTGATATGGG + Intronic
1033913548 7:146294792-146294814 CAGAATGTTGTCAGTCATATTGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036221548 8:6925173-6925195 CAAACTGGAGACAGTCATATGGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037092589 8:14941188-14941210 CAAAATGTAGAAAGTTATATTGG - Intronic
1038469504 8:27801995-27802017 CTAAATGCTGAATGTGATACTGG - Intronic
1038645264 8:29355833-29355855 CAAAAAGCTGACAGTCTCATTGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039046588 8:33456055-33456077 AAAAATGCTGAGAGAGCTATTGG - Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1041149407 8:54915709-54915731 CACAATGCTGACAGTTATTTTGG - Intergenic
1043142202 8:76603944-76603966 GAAAAGGCTGACAGTCATCTAGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045977695 8:108148276-108148298 GAGAATGCTGACAGTGATTAAGG - Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046316016 8:112502472-112502494 CCAAGTGATGACAGAGATATCGG + Intronic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052511011 9:29420641-29420663 CAAATTGCTGACAGAGATGAGGG - Intergenic
1052530356 9:29675251-29675273 CAAAGTGCTGACAAAGATTTTGG + Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1053328625 9:37182140-37182162 GAAAATGTTGACAGGGAAATAGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055624546 9:78161791-78161813 CCAAATGCTGACAGGCAGATTGG + Intergenic
1056076602 9:83047964-83047986 CCAAATGTTGACAGTGATGCTGG - Intronic
1057032493 9:91786652-91786674 CAAAATGTTGACTCTGTTATGGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058433097 9:104936567-104936589 CAAAATGCTGAAAGAGAAAGAGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059889154 9:118781941-118781963 AAGAATGCTGACAGTGACATTGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060244909 9:121936990-121937012 CAAAATGCAGACAAGGATTTTGG + Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186060782 X:5703927-5703949 CAAAAAGCTCACAATTATATGGG + Intergenic
1186343414 X:8666751-8666773 CAAAATGTGGACATTGACATCGG + Intronic
1187753272 X:22491126-22491148 AAACATGCTGACAGTGATCCTGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192632603 X:72789064-72789086 CATAATGAGGACATTGATATGGG + Intronic
1192649106 X:72931737-72931759 CATAATGAGGACATTGATATGGG - Intronic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194270731 X:91811427-91811449 TAAAATGTTAACAGTGAGATTGG + Intronic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1194646438 X:96464011-96464033 CAAACTAATTACAGTGATATTGG + Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196327125 X:114419804-114419826 CCAAATGCTGACTAAGATATGGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198993438 X:142544346-142544368 TAAAAGGATGACAGTCATATTGG - Intergenic
1200587964 Y:5032860-5032882 TAAAATGTTAACAGTGAGATTGG + Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic