ID: 1130765640

View in Genome Browser
Species Human (GRCh38)
Location 15:86868020-86868042
Sequence ATACACAATCTGACATCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130765640_1130765642 15 Left 1130765640 15:86868020-86868042 CCAAGAGATGTCAGATTGTGTAT 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1130765642 15:86868058-86868080 AAAATAAGGAATTATCAATGTGG 0: 1
1: 0
2: 2
3: 47
4: 517
1130765640_1130765641 1 Left 1130765640 15:86868020-86868042 CCAAGAGATGTCAGATTGTGTAT 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1130765641 15:86868044-86868066 TTTTACAGTTTTTCAAAATAAGG 0: 1
1: 1
2: 10
3: 98
4: 1076
1130765640_1130765643 24 Left 1130765640 15:86868020-86868042 CCAAGAGATGTCAGATTGTGTAT 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1130765643 15:86868067-86868089 AATTATCAATGTGGCTAATCCGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130765640 Original CRISPR ATACACAATCTGACATCTCT TGG (reversed) Intronic
901631117 1:10648675-10648697 AGCCACAATATTACATCTCTAGG - Intronic
905319828 1:37108013-37108035 TTCCACAATCTGAGACCTCTTGG - Intergenic
907785507 1:57608247-57608269 ATACACAATGTAACCTCTCTGGG + Intronic
910686917 1:89927028-89927050 ATACAATATCTGAAAGCTCTGGG - Intronic
912213857 1:107584834-107584856 ATAAATAATCTGAAATCCCTAGG - Intronic
912914456 1:113799193-113799215 ATACACAATCCCCAATCTCTTGG + Intronic
914784607 1:150817136-150817158 ATAAACCATCTGACTTCTCAAGG + Exonic
918126611 1:181589509-181589531 ATATACAAGCAGAGATCTCTGGG + Intronic
919468033 1:197945768-197945790 AAACACAATTTGAAAGCTCTTGG + Intergenic
919820931 1:201471481-201471503 TTACATTATCTGACCTCTCTGGG - Intergenic
919928728 1:202207561-202207583 ACACAGGATCTGACATCTGTGGG - Intronic
921398151 1:214690824-214690846 ATACAAAATCTAACCACTCTGGG + Intergenic
923518997 1:234721539-234721561 ATACCCAACCTGCTATCTCTGGG - Intergenic
1065726533 10:28672597-28672619 ATACTCAGTCTGTGATCTCTTGG - Intergenic
1066425621 10:35305077-35305099 ATATAAAATCTGACATTGCTTGG + Intronic
1066437696 10:35409105-35409127 ATACACAATCTAACAGCCATTGG - Intronic
1069424977 10:68280540-68280562 ATATAAAAAGTGACATCTCTGGG - Intergenic
1071062543 10:81590015-81590037 TTACACAATCTTATATTTCTTGG - Intergenic
1071642927 10:87332893-87332915 ATACACCCTCTGACGGCTCTAGG - Intergenic
1072312334 10:94168380-94168402 GTACACAATATGAAATCCCTGGG + Intronic
1072945614 10:99807599-99807621 ATAGACTAGCTGGCATCTCTAGG + Intronic
1078211528 11:9273888-9273910 ATACACAAGCTCACACATCTGGG - Intergenic
1078263597 11:9735496-9735518 ATACATGTTCTGATATCTCTAGG + Intronic
1079684314 11:23338055-23338077 AGACATAATCTGAAATATCTGGG + Intergenic
1080256569 11:30296785-30296807 TTACATAATCTCACATTTCTTGG - Intergenic
1080791050 11:35523046-35523068 ATATACAATCTGAGAGCTCCTGG - Intronic
1083590882 11:63893902-63893924 ATACATAATCAGATATCTCAGGG - Intronic
1085344671 11:75760701-75760723 TTACAGAATCTGTAATCTCTAGG - Intronic
1085439117 11:76541768-76541790 ATACACATTCTTTAATCTCTTGG - Intronic
1087009876 11:93503108-93503130 ATACAGGACCTGACCTCTCTGGG - Intronic
1087359581 11:97141539-97141561 ATCCACAATCACACATTTCTGGG - Intergenic
1087523727 11:99279935-99279957 AGACACAATCTGAGGTTTCTAGG + Intronic
1089071531 11:115703444-115703466 CAACACATTCTGACATTTCTGGG - Intergenic
1090890398 11:130917937-130917959 ATTCACATTCTGCCATCTCACGG - Intergenic
1098061927 12:66572262-66572284 AAACACCATCTAACATCTCCTGG - Intronic
1098240180 12:68459019-68459041 TTATATAATCTGATATCTCTGGG + Intergenic
1098966880 12:76799889-76799911 ATACACAATGAGAGATCTTTGGG + Intronic
1099807719 12:87541605-87541627 ATATTCAGTCAGACATCTCTAGG + Intergenic
1100361697 12:93885392-93885414 ATAAAGAAACTGACATCCCTAGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101655275 12:106714932-106714954 ATACACACTTTGAAATTTCTGGG + Intronic
1103134058 12:118492383-118492405 TTAGCCAATCTCACATCTCTGGG - Intergenic
1108438557 13:50425631-50425653 AAAAACAACCTCACATCTCTGGG - Intronic
1111515328 13:89323695-89323717 ATAAACATTCTGTCATCTCTTGG - Intergenic
1112618751 13:101033919-101033941 ATATACCATCTGGTATCTCTTGG + Intergenic
1113839645 13:113351493-113351515 ACACACAAGCTGACAACTCGAGG - Intronic
1116283917 14:42947105-42947127 TTACACAATCCAACATTTCTAGG - Intergenic
1119470409 14:74894266-74894288 ATTGACAATCTGATCTCTCTGGG - Intronic
1121909058 14:97772486-97772508 TTATACTATGTGACATCTCTGGG + Intergenic
1122753766 14:103960698-103960720 AAACACAAGCTGACATTTTTAGG - Intronic
1123875551 15:24620643-24620665 ATACATAATCTCATATTTCTTGG + Intergenic
1124196571 15:27636364-27636386 ATACACTAACTTACATTTCTTGG + Intergenic
1127005688 15:54567066-54567088 ATGCACAGACAGACATCTCTTGG - Intronic
1127312630 15:57766234-57766256 ACACAAAATCTGTCAACTCTGGG + Intronic
1128824094 15:70694185-70694207 ATAAACATTCTCACTTCTCTGGG - Intronic
1130051215 15:80485571-80485593 ATACAGAATGGGACATGTCTGGG + Intronic
1130625537 15:85510347-85510369 ATACATATACTGACTTCTCTAGG - Intronic
1130765640 15:86868020-86868042 ATACACAATCTGACATCTCTTGG - Intronic
1131570319 15:93528406-93528428 AAACAAAATCTAAAATCTCTAGG + Intergenic
1131920789 15:97326223-97326245 AAAAACAATCTTACATCTTTGGG - Intergenic
1132261206 15:100426547-100426569 ATATACCATCTGTCTTCTCTGGG + Intronic
1136078822 16:27838380-27838402 ATACACAGTTTGAAAACTCTGGG + Intronic
1138859148 16:60734075-60734097 AAACACAATCTGTCTTCTTTGGG + Intergenic
1139009289 16:62612592-62612614 ATAGAAAAACTGACCTCTCTGGG - Intergenic
1140152614 16:72385987-72386009 ATACACAATAAGACATCTTGGGG + Intergenic
1140762042 16:78118452-78118474 ATGAACAAACTGCCATCTCTGGG + Intronic
1142798613 17:2329238-2329260 TTTCAAAATCTTACATCTCTGGG - Intronic
1144086567 17:11814390-11814412 ATACAAAATCTGTCATAGCTAGG - Intronic
1155072365 18:22327715-22327737 GTACACAATCTGACAGCACAGGG - Intergenic
1158032878 18:52988101-52988123 ATAAATAATCTGAAATGTCTTGG + Intronic
1158466455 18:57694483-57694505 ATACAAAATCTTACCTCTTTAGG - Intronic
1159415518 18:68142806-68142828 ATCCATAATCTGACTTTTCTGGG + Intergenic
1165588993 19:36949298-36949320 AGACAAAAACTGACATCTGTAGG - Intronic
1166601283 19:44096998-44097020 AGAGACAAACTGACATCACTTGG - Intronic
1168710617 19:58498025-58498047 ATACACAATCTGACAAAGCCTGG - Intronic
925395462 2:3530167-3530189 TTACACAGTCTCACATCTCATGG - Intergenic
930404857 2:50942201-50942223 ATACATCCTCTGAAATCTCTAGG - Intronic
931495935 2:62807220-62807242 TTACACAAACTGATATCTATTGG + Intronic
934197369 2:89850526-89850548 ATTCACAGTTTTACATCTCTGGG - Intergenic
934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG + Intronic
935409453 2:102745067-102745089 ATACACTATCCAACATCTGTTGG - Intronic
939694543 2:145308358-145308380 ATACCAACTATGACATCTCTGGG - Intergenic
939748941 2:146016076-146016098 ATTCAAAATCAGACATCTCAAGG - Intergenic
939881606 2:147637770-147637792 ATACACAATATGAAATATGTAGG + Intergenic
942016030 2:171816785-171816807 ATACACAATCTGTCCTTTCAAGG + Intronic
943404713 2:187465822-187465844 CTACAGAAACTGACATGTCTTGG + Exonic
945324607 2:208468007-208468029 ATGCAGCAGCTGACATCTCTAGG + Intronic
945628537 2:212240815-212240837 ATACACAAGTTCACATCTTTGGG + Intronic
945634979 2:212337594-212337616 ATACAGAATGTGACTCCTCTGGG - Intronic
947367938 2:229415954-229415976 ATACACAATTTGAGATTTCCTGG - Intronic
947397569 2:229701693-229701715 ATACAAAATTTGGCATCTCCAGG + Intronic
947562305 2:231166885-231166907 ATACACTATCTTGCATCCCTTGG - Intronic
947749770 2:232526073-232526095 AAACACAATCTGACACCTCATGG - Intronic
947959346 2:234221913-234221935 ATACTCCCTCTGACACCTCTAGG + Intergenic
1174292924 20:49521731-49521753 TTGCACAAGCTGACATTTCTGGG - Intronic
1175373996 20:58512571-58512593 GTACTCAATCTGAATTCTCTTGG + Intronic
1175617961 20:60419286-60419308 ATCCACAATCCCACATTTCTTGG + Intergenic
1177506215 21:22021040-22021062 ATACAAAATGTGTGATCTCTAGG - Intergenic
1181390144 22:22574332-22574354 ATCCACAATCAGACCTTTCTGGG + Intergenic
1181750543 22:24986173-24986195 AACCAGAATCTGACATCCCTTGG - Intronic
1184933003 22:47695395-47695417 AGGCCCACTCTGACATCTCTCGG + Intergenic
949191762 3:1258137-1258159 AATCACAATCTAACAGCTCTGGG - Intronic
951285958 3:20814221-20814243 GTACACAATCTGACTGCTTTTGG + Intergenic
952597429 3:35035103-35035125 AAAGACAATCTGAAATTTCTAGG + Intergenic
955716826 3:61838117-61838139 ATTCACCATCTGAAATCTCAGGG - Intronic
956543855 3:70376777-70376799 ATTAACAATATGACATTTCTGGG - Intergenic
958544517 3:95525841-95525863 ATACAAAATGTGACATATATAGG - Intergenic
959794241 3:110404299-110404321 GTTCACAATTTTACATCTCTAGG + Intergenic
961001963 3:123380011-123380033 GGACACAACCAGACATCTCTAGG + Intronic
961856210 3:129873889-129873911 ATCCAAAATCTGAAATCTTTTGG - Intronic
963367376 3:144353650-144353672 ATTCTCAACCTGACAACTCTAGG + Intergenic
963497469 3:146084141-146084163 ATACACTATTTCATATCTCTAGG + Intronic
964671185 3:159228312-159228334 ATACCAATTCTGACATATCTCGG + Intronic
966793445 3:183693573-183693595 AAACAAAATGTGACATCTGTAGG + Intergenic
970115685 4:12693415-12693437 ATAAACAATGTAACATTTCTTGG + Intergenic
971034241 4:22675768-22675790 ATACACAATCTTACTTCTATGGG + Intergenic
971728400 4:30344103-30344125 ACAATCTATCTGACATCTCTTGG - Intergenic
972657415 4:41077925-41077947 AAACACAATGGCACATCTCTTGG - Intronic
975423728 4:74201674-74201696 ATACAAAACAAGACATCTCTTGG + Intronic
975720663 4:77245753-77245775 ACACACACTCTGACATCCTTAGG + Intronic
978275632 4:106946597-106946619 AGACATAATCTCAAATCTCTTGG + Intronic
981252709 4:142623397-142623419 ACACACAAGCTGACACCTTTTGG + Intronic
981344239 4:143656926-143656948 ATAAACAATCAGACACTTCTGGG - Intronic
981762713 4:148211263-148211285 ATACACAATCTTATATTTTTCGG - Intronic
982639955 4:157945783-157945805 CTACACAGTGTGACATCACTGGG - Intergenic
982714241 4:158790166-158790188 ATACACATTATGAGATATCTTGG - Intronic
983009228 4:162524476-162524498 CTACATAATCTCACATCACTTGG - Intergenic
983830989 4:172328549-172328571 TTACATAATCTCACATTTCTTGG + Intronic
984185064 4:176533655-176533677 ATAGACAATTTGGGATCTCTAGG + Intergenic
987062467 5:14255623-14255645 ATACAAAATGAGACATCTCGAGG + Intronic
987950029 5:24662835-24662857 ATATATGAACTGACATCTCTGGG - Intergenic
990707213 5:58542797-58542819 ATTTAAAATGTGACATCTCTAGG - Intronic
991055910 5:62320092-62320114 ATATACAATATAACATCTGTAGG - Intronic
992655300 5:78903451-78903473 ACAAAGAATCTGACATGTCTTGG - Intronic
994469501 5:100184986-100185008 ATACACAATCTGAAATATTTAGG - Intergenic
996215556 5:120860950-120860972 ACACACAATCAGTCATCCCTTGG - Intergenic
997809765 5:136955852-136955874 AAATACTTTCTGACATCTCTTGG - Intergenic
1001517394 5:172365514-172365536 AGGCTCAGTCTGACATCTCTGGG + Intronic
1002883672 6:1274760-1274782 ATACACTATCTCACATCATTAGG + Intergenic
1003306533 6:4934009-4934031 ATACACATTGTTACATCTCATGG - Intronic
1003742998 6:8964803-8964825 ATACTCAAACTGATAACTCTAGG - Intergenic
1008027046 6:46650184-46650206 ATACACAATGAGACTTCTCTGGG + Intronic
1008372460 6:50748967-50748989 AGAAACAATCTTACATCTCAAGG - Intronic
1009290611 6:61876719-61876741 ATATGCAAACTGCCATCTCTGGG + Intronic
1014241177 6:119019239-119019261 ATTTACAATCTCTCATCTCTTGG - Intronic
1015713363 6:136165592-136165614 TTCTACAATCTGTCATCTCTTGG + Intronic
1020670453 7:11101097-11101119 ATAAGCAATGTGACTTCTCTTGG - Intronic
1021561640 7:21973491-21973513 ACACACACACTGACATCTGTGGG + Intergenic
1022121388 7:27311815-27311837 ATACATAAACTGACATATTTCGG - Intergenic
1023664376 7:42506520-42506542 AGACACAAACGGACATCTCCAGG - Intergenic
1028901168 7:96101844-96101866 ATACAAAATATTACATCTCAGGG + Intronic
1031243176 7:119271386-119271408 ATACACAATTACACATCTCTTGG - Intergenic
1032380023 7:131469252-131469274 AGACAGAATCTGCCATCTCATGG + Intronic
1035919252 8:3659213-3659235 ATACACAATTTCACCTCCCTGGG - Intronic
1036775138 8:11606384-11606406 ATGCACACTCTGACACCCCTTGG - Intergenic
1037857004 8:22379010-22379032 ATACTCCTTCTGACAGCTCTAGG + Intronic
1038350124 8:26768702-26768724 ATACATAATCAAATATCTCTGGG - Intronic
1039616045 8:38955776-38955798 ACACACAATCTAACATCTGATGG + Intronic
1045163011 8:99570152-99570174 ATCCACAAGCAGACATATCTTGG - Intronic
1047031219 8:120883305-120883327 AGACAAAATCTGTCCTCTCTGGG - Intergenic
1050377392 9:4986717-4986739 ATACAAAATCAGACATCTTGAGG + Intronic
1052485351 9:29091152-29091174 GTTCCAAATCTGACATCTCTTGG + Intergenic
1057646932 9:96885173-96885195 ATACTCTATCTGATTTCTCTTGG - Intergenic
1186102619 X:6173084-6173106 CTCCACTCTCTGACATCTCTGGG + Intronic
1186484922 X:9926838-9926860 ATACATAATGAGACATCTCGGGG - Intronic
1186649461 X:11542780-11542802 ACACACAATCTGTCACATCTTGG + Intronic
1186991318 X:15071883-15071905 ACACACACTCTGACATTACTGGG + Intergenic
1192829233 X:74732832-74732854 ATGGAAAATCTGACATCTTTTGG + Exonic
1195607024 X:106817599-106817621 ATACACATACTGAGATATCTTGG - Intronic
1198230354 X:134683312-134683334 ATACCCTAACTGACATCTCTAGG - Intronic
1198867785 X:141143810-141143832 AAACACAACATGACATCACTGGG + Intergenic