ID: 1130765934

View in Genome Browser
Species Human (GRCh38)
Location 15:86871280-86871302
Sequence TATCTGCAGAGACCCTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130765927_1130765934 30 Left 1130765927 15:86871227-86871249 CCTAGAGACATCCATCTGTCAGA 0: 1
1: 0
2: 1
3: 20
4: 144
Right 1130765934 15:86871280-86871302 TATCTGCAGAGACCCTCAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 157
1130765931_1130765934 19 Left 1130765931 15:86871238-86871260 CCATCTGTCAGATATGGGGCTTG 0: 1
1: 1
2: 2
3: 17
4: 231
Right 1130765934 15:86871280-86871302 TATCTGCAGAGACCCTCAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130765934 Original CRISPR TATCTGCAGAGACCCTCAAA AGG Intronic
902251617 1:15157169-15157191 GCTCAGCAGAGACCCTCAGAGGG - Intronic
903116722 1:21184365-21184387 TGTCTGCAGAGACTGTCAACAGG + Intergenic
904998137 1:34647360-34647382 TCTCTGCAGAGACCCAGACAAGG + Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
908177825 1:61573176-61573198 TACCTGCAGAGACTATTAAAAGG - Intergenic
909159077 1:72121912-72121934 TATCTGCATTGCCCCACAAAAGG - Intronic
912368521 1:109154585-109154607 TGTCTGGAAAGCCCCTCAAATGG - Intronic
917074244 1:171187325-171187347 TATCAGCAGAGACCATATAAAGG + Intronic
917934481 1:179851352-179851374 TATCTCAATAGACTCTCAAAAGG - Exonic
920155979 1:203951679-203951701 GAGCTGCAGAGACCTACAAAGGG + Intergenic
921251467 1:213302296-213302318 TAGCTGCAGAAACCTACAAAAGG - Intergenic
921433304 1:215087256-215087278 TATCTGCAGATACTTTAAAAAGG - Intronic
922500159 1:226091357-226091379 GAGCTGCAGGGACCCTGAAAGGG - Intergenic
922810916 1:228415100-228415122 TCTCTCCAGAGTCCCTCAAGCGG - Exonic
924882751 1:248180485-248180507 TATTTCCCGAGACCCACAAAAGG - Exonic
1063029922 10:2224393-2224415 AATCTGCCCAGACCCTCTAAGGG + Intergenic
1064770571 10:18718346-18718368 TATATCCAGAGAGCATCAAAGGG - Intergenic
1065017263 10:21473690-21473712 TCTCTGCAGATACCCACATACGG - Intergenic
1067055739 10:43048827-43048849 CATCTGCAGTGACCCTCCTAAGG - Intergenic
1067518673 10:46977857-46977879 TAACAGCAGACACCCTAAAAGGG - Intronic
1067643575 10:48073977-48073999 TAACAGCAGACACCCTAAAAGGG + Intergenic
1067752883 10:48983570-48983592 GATTTGCAGAGCTCCTCAAAAGG + Intergenic
1069004089 10:63297934-63297956 GATCTGCAGAGCCCCCAAAAAGG - Intronic
1078551305 11:12282251-12282273 TTTCTGCACAGCCCCACAAATGG - Intronic
1078624724 11:12944276-12944298 TATTTGCAGAAACTTTCAAAAGG + Intronic
1078724095 11:13913092-13913114 TATTTGCAGATACCCTGCAAAGG - Intergenic
1081786268 11:45750009-45750031 TCTCTACAGAGACCCAGAAAGGG - Intergenic
1083353398 11:62047272-62047294 TATTTTCAGAGATCCTCAAAGGG + Intergenic
1086170759 11:83833757-83833779 TTTCTGCAGAGAGCCTCGCAAGG - Exonic
1087809924 11:102599498-102599520 TATCTGCACAAACACTTAAAAGG + Intronic
1090028068 11:123184621-123184643 TCTCTGCAGAGGACCTAAAAGGG + Intronic
1090578776 11:128137428-128137450 TGTCTGTAGAGATCTTCAAAGGG - Intergenic
1091062260 11:132474605-132474627 TTTCTGCAGTGGCCCCCAAATGG + Intronic
1091352477 11:134908085-134908107 TAACTGCAGAGACCCAAATATGG + Intergenic
1092032613 12:5300760-5300782 CATCTGCAGAAACCCACAATCGG + Intergenic
1092780793 12:11984928-11984950 AACCTGCAGAGACGCTCACATGG + Intergenic
1096765577 12:53886028-53886050 CACCTGCAGAGAGCCTCATATGG - Intergenic
1096794294 12:54065155-54065177 GACCTGCAGAGCTCCTCAAAGGG + Intergenic
1097580255 12:61447147-61447169 TATTTCCAGAGAACCCCAAATGG - Intergenic
1099825728 12:87775026-87775048 TTTCAGCAGAAACCCTAAAAGGG + Intergenic
1102350749 12:112190408-112190430 TAACTGCATAGTTCCTCAAAGGG - Intronic
1104011165 12:124931176-124931198 TATCTGCCCAGAACCTCAAAAGG - Intergenic
1104119300 12:125783763-125783785 GAGCAGCACAGACCCTCAAAGGG + Intergenic
1107702430 13:43061447-43061469 TCACTGCAAAGACCATCAAAAGG - Intronic
1113292598 13:108923114-108923136 TATTTGCAATGACCCACAAAAGG + Intronic
1113659329 13:112094768-112094790 TATTTGCTGAGAACCTCTAATGG - Intergenic
1114232254 14:20793728-20793750 TGTCTGCTGAGAACATCAAATGG + Intergenic
1114535672 14:23420763-23420785 GATCCACAGAGACCCTGAAAAGG - Intronic
1116769358 14:49109365-49109387 TATATCCAGAAACCCTCTAATGG + Intergenic
1117859556 14:60075249-60075271 TGTCTGCAGAAACCCTACAAGGG + Intergenic
1118268019 14:64314075-64314097 TTCTTGCATAGACCCTCAAAAGG - Intronic
1119182865 14:72616022-72616044 TTTCTGCAGAGGCCACCAAATGG - Intergenic
1120447724 14:84622218-84622240 TATCAGTAGAGACCCCCAAACGG - Intergenic
1121852640 14:97236198-97236220 TTTCTGCAGAGACTCTCCCAAGG - Intergenic
1127053505 15:55109077-55109099 TAGCTGCAGAGGCCATCAAGAGG - Intergenic
1129230195 15:74192781-74192803 GCTCTGCAGAGACCCTCAAAGGG - Intronic
1130765934 15:86871280-86871302 TATCTGCAGAGACCCTCAAAAGG + Intronic
1130843767 15:87725469-87725491 TATCTGCAGAATCCGTCAATAGG - Intergenic
1131138136 15:89954670-89954692 TATCTGCAGAGAATATCTAAGGG + Intergenic
1135410145 16:22227699-22227721 TATCAGCAGAGACATTCAAGCGG + Intronic
1136901800 16:34048149-34048171 TGACTGCATAGACCCTAAAAGGG + Intergenic
1138031489 16:53562827-53562849 TATCTGCATAGACCTTGAGATGG + Intergenic
1139545217 16:67646798-67646820 TGTCTCCAGAGCCCTTCAAAAGG - Intronic
1142148571 16:88502869-88502891 TGTGTGCAGAGACCCACAAACGG - Intronic
1145984257 17:29034138-29034160 AATATGCTGAGACCCCCAAAGGG + Intronic
1146690521 17:34871887-34871909 TTTCTCCAGAGAAACTCAAAGGG - Intergenic
1150440051 17:65183746-65183768 TATCTGCAGAGAAACTCAGGTGG - Intronic
1160362211 18:78293573-78293595 CATCTCCACAGACCCTCAGATGG + Intergenic
1160963441 19:1734974-1734996 GAGCAGCAGAGACCCTCAAGAGG + Intergenic
1161653179 19:5497696-5497718 CATGTGGAGAGAACCTCAAAAGG + Intergenic
1163519032 19:17781110-17781132 TTTCTGCAGAGACCCCCAATGGG - Intronic
929854711 2:45627054-45627076 TATCTTCAGAGTCCCTGGAAAGG - Intergenic
932338184 2:70943007-70943029 CAGCTGCAGAGACCCACACATGG - Intronic
932404054 2:71502250-71502272 TATTTGCAGAGACCAGAAAAGGG + Intronic
933479076 2:82832123-82832145 TATCTGAGGAAACCCTCAGAAGG + Intergenic
935845306 2:107159815-107159837 TGGCTGCAGAGACCCTCAATGGG + Intergenic
936175383 2:110215239-110215261 TCTCTGCAGAGATCAGCAAATGG + Intergenic
937805427 2:126137581-126137603 TATCTTAAGAGACCATCAAAGGG + Intergenic
944883263 2:204037233-204037255 TAATTTCAGTGACCCTCAAAAGG + Intergenic
945313020 2:208337704-208337726 TTTTTGCAGAGTCCCTGAAAAGG - Intronic
945550444 2:211215071-211215093 TTTATTCAGAGAGCCTCAAATGG - Intergenic
945841278 2:214890696-214890718 CCTCTGCAGAGATGCTCAAATGG + Intergenic
946240447 2:218351012-218351034 GAACTTCAGAGACCCTAAAAGGG - Intergenic
947112777 2:226737466-226737488 TATCTACAGAGTGCATCAAAGGG + Intronic
948485145 2:238276016-238276038 AATCTACAGAGCCCCACAAAGGG - Intronic
948485156 2:238276078-238276100 AATCTACAGAGCCCCACAAAGGG - Intronic
948485167 2:238276140-238276162 AATCTACAGAGCCCCACAAAGGG - Intronic
1170196160 20:13691925-13691947 TATTTTCAGAGACAATCAAATGG - Intergenic
1171970641 20:31562931-31562953 GAGCTGCAGAGACCTCCAAAAGG - Intronic
1172608237 20:36230114-36230136 CATCTGCAGTGGCCCTCAGAAGG - Exonic
1173013079 20:39200145-39200167 CAGCTGCAGAGAGGCTCAAAAGG - Intergenic
1173299104 20:41784882-41784904 TATCTACAGAGAGGCTGAAATGG - Intergenic
1174135535 20:48376273-48376295 TCTCTGCTGAAACCCTCTAATGG - Intergenic
1175853671 20:62107395-62107417 TATCTACAGAGCCCCAGAAAAGG + Intergenic
1178510412 21:33200691-33200713 CATCTGCAGAGGCCACCAAATGG + Intergenic
1179421639 21:41241134-41241156 TTTCTCCAGAGAGACTCAAAGGG - Intronic
1181327614 22:22062102-22062124 TACCTTCAGAAACCCCCAAAGGG - Intergenic
1181972425 22:26701495-26701517 TGTCTCCAGGTACCCTCAAAAGG + Intergenic
1182723329 22:32422396-32422418 TTGCTGCAGAGACTCTAAAAAGG + Intronic
1182890633 22:33815823-33815845 CATCTGCAGAGAACCAGAAAGGG + Intronic
1183207009 22:36426523-36426545 TGTCTTCAGAGCCCCTCAAATGG - Intergenic
950696432 3:14704328-14704350 TCTCTGCAGAGAAGCTGAAAGGG + Exonic
954191748 3:48967712-48967734 TATCTGCAAAGTCCCACAATTGG + Intronic
954968090 3:54628480-54628502 TCTCTGCCTAGACCCTCCAATGG - Intronic
955685577 3:61545326-61545348 CAACTGCAGAGACCCTGAAATGG + Intergenic
955995585 3:64677302-64677324 TAAATGCAGAGACACTCAAATGG + Intronic
956511342 3:69996614-69996636 TATATGCAAAGATCCTCAATTGG + Intergenic
959266180 3:104141841-104141863 TATATGCAAAGACCCAGAAATGG - Intergenic
960210411 3:114958050-114958072 TTTGTGTAGAGACACTCAAATGG - Intronic
962563447 3:136632868-136632890 TATCTGCAAATACCCACAGAGGG + Intronic
962957067 3:140276073-140276095 AAGCTGCAGAGACCTTGAAAGGG + Intronic
965437239 3:168667153-168667175 CTTCTGCAAAGACCCTTAAAAGG + Intergenic
968272644 3:197416380-197416402 TGTCTGCAGAGACCTTGAAGAGG + Intergenic
970296723 4:14638778-14638800 AATCTTCAGGGACCCTGAAAGGG + Intergenic
973653395 4:53020417-53020439 AATTTTCAGAGAGCCTCAAAAGG + Intronic
977251186 4:94691528-94691550 TATCTACAGAACCTCTCAAAAGG - Intergenic
980003075 4:127512898-127512920 TCACTGCAAAGACCATCAAAAGG - Intergenic
981385012 4:144119768-144119790 TATATGCAGATACGCACAAACGG - Exonic
981549345 4:145927686-145927708 TGTCTCAAGAGACCATCAAATGG + Intronic
982070908 4:151693575-151693597 GATCTGCAGAGGCTCTGAAATGG + Intronic
983828338 4:172293952-172293974 TATTAACAGAGACCCTGAAATGG - Intronic
985192703 4:187393471-187393493 TATCTGCAGGAACCTCCAAAAGG - Intergenic
985846526 5:2353797-2353819 TTTCTGCAGAGACTCTTAGAGGG - Intergenic
986560096 5:9052026-9052048 TCTCTGCAGAGACCAGAAAAGGG + Exonic
988090723 5:26537585-26537607 CATTTTCAGAGATCCTCAAAGGG - Intergenic
993459609 5:88167038-88167060 TATTTTCAGATAACCTCAAAAGG + Intergenic
993472290 5:88320682-88320704 TATCTAATGAGACCCTCCAAGGG - Intergenic
993623759 5:90198761-90198783 TATATGCAGGGACCCAGAAATGG + Intergenic
993661225 5:90637360-90637382 TATTTTCAGAGAACCTCTAATGG + Intronic
996880024 5:128286557-128286579 TATTAGCAGAGACCCTGAGATGG + Intronic
999053501 5:148549187-148549209 CATCTGCATTGGCCCTCAAAAGG - Intronic
1000479074 5:161748524-161748546 TATCTAAAAGGACCCTCAAAAGG + Intergenic
1000522013 5:162307079-162307101 AATATGCAGTGTCCCTCAAAAGG - Intergenic
1001441470 5:171746914-171746936 TATGTGCAGAAACCATCTAATGG - Intergenic
1001838799 5:174855502-174855524 TACCTGCAGGGACCTTCCAAAGG - Intergenic
1003031115 6:2601660-2601682 TATCTGCTAAGACCCTTAATGGG - Intergenic
1005513074 6:26529482-26529504 TATCTCCAGAGACCAGCACAGGG - Intergenic
1007798691 6:44372911-44372933 ATTCTGCAGAGACTCTAAAAGGG - Intronic
1009468071 6:63998237-63998259 TATCTGCAAGAACCCTGAAAAGG - Intronic
1010757896 6:79687969-79687991 TCTCTCCAGAGACACTGAAAGGG + Intronic
1010834151 6:80566212-80566234 TATCTGCAGAGAGTCACAGAAGG - Intergenic
1015056912 6:128913900-128913922 CACCTACAGATACCCTCAAAAGG - Intronic
1017300693 6:152854481-152854503 TATTTCCAGAGACCTTCACAGGG - Intergenic
1018336204 6:162792559-162792581 TATCTACACAGGCCCTGAAATGG + Intronic
1019278009 7:186333-186355 TATTTTCAAAGACCCTCAGACGG + Intergenic
1023365618 7:39460536-39460558 CATCTCCACAGATCCTCAAACGG + Exonic
1030030869 7:105368338-105368360 TCTCTGAAGAGACCCTTAACAGG - Intronic
1031030591 7:116730228-116730250 CATCTGCAGAGGCCCTTAATGGG + Intronic
1031135052 7:117874832-117874854 TTTCTGCAAAGACCCTGAAAGGG + Intergenic
1031354902 7:120778531-120778553 TCACTGCAAAGACCATCAAAAGG - Intergenic
1031485481 7:122318162-122318184 AATCTGGAAAGAACCTCAAAGGG + Intergenic
1035328097 7:158077723-158077745 AGTCTGCAGAGACCCTCACCCGG - Intronic
1035343835 7:158184993-158185015 TATCTACTGAGACCATCACATGG + Intronic
1036149842 8:6287061-6287083 TATCTCCACAGCCTCTCAAAAGG + Intergenic
1038504184 8:28070421-28070443 TATCAGCATAGAAACTCAAAGGG + Intronic
1038579150 8:28732172-28732194 TCCCTGCAGTGACCCTCAAGTGG - Intronic
1038962636 8:32538162-32538184 AATATGCTGAGACCCTCAGAGGG - Intronic
1039433145 8:37541338-37541360 TCTCTGCTAAGACCCTGAAAAGG - Intergenic
1041462121 8:58122702-58122724 CATTTGCAGAGAACTTCAAAAGG - Intronic
1041733598 8:61087342-61087364 TTCTTGCAGAGACCCCCAAAGGG + Intronic
1056459846 9:86799301-86799323 TATGTGCAGAGAACTTCAAGAGG - Intergenic
1058013887 9:100008539-100008561 TTTATGGAGAGATCCTCAAAAGG - Intronic
1058031270 9:100200697-100200719 TGTCTGCAGAAACCCACAAAAGG - Intronic
1058087784 9:100767874-100767896 TGTCTTCAGAGGCCCTAAAAAGG - Intergenic
1059808528 9:117830431-117830453 TGTCTGCAGTGAGCATCAAATGG + Intergenic
1061092350 9:128433812-128433834 TATCTGCAGGGGCCCTCAGGAGG - Intronic
1185926529 X:4153241-4153263 TATCTGCAAGGACCAGCAAAAGG + Intergenic
1186899751 X:14041454-14041476 TATGTGCAGAGAGCTCCAAAAGG + Intergenic
1194214829 X:91117316-91117338 TATTGGCAGAGGCCATCAAATGG + Intergenic
1195255232 X:103083271-103083293 TATCTGCAGAGAACCCAAGAGGG + Exonic
1197649891 X:129052952-129052974 TAAATGCAGACACCCTCAAAAGG - Intergenic
1200023314 X:153230471-153230493 TATCTGCTGAGACATTCCAAAGG - Intergenic